Skip to Content
Merck
All Photos(1)

Key Documents

EHU058161

Sigma-Aldrich

MISSION® esiRNA

targeting human CYP1A1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGATAAGCACGTTGCAGGAGCTGATGGCAGGGCCTGGGCACTTTAACCCCTACAGGTATGTGGTGGTATCAGTGACCAATGTCATCTGTGCCATTTGCTTTGGCCGGCGCTATGACCACAACCACCAAGAACTGCTTAGCCTAGTCAACCTGAATAATAATTTCGGGGAGGTGGTTGGCTCTGGAAACCCAGCTGACTTCATCCCTATTCTTCGCTACCTACCCAACCCTTCCCTGAATGCCTTCAAGGACCTGAATGAGAAGTTCTACAGCTTCATGCAGAAGATGGTCAAGGAGCACTACAAAACCTTTGAGAAGGGCCACATCCGGGACATCACAGACAGCCTGATTGAGCACTGTCAGGAGAAGCAGCTGGATGAGAACGCCAATGTCCAGCTGTCAGATGAGAAGATCATTAACATCGTCTTGGACCTCTTTGGAGCTG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Hanna Piotrowska-Kempisty et al.
Toxicology letters, 267, 59-66 (2017-01-04)
The role of CYP1A1 and CYP1B1 enzymes in the biotransformation and biological activity of the methylated resveratrol analogue, 3,4,5,4'-tetramethoxystilbene (DMU-212) is still elusive. Our recently published data have shown that one of the metabolites of DMU-212, 3'-hydroxy-3,4,5,4'-tetramethoxystilbene (DMU-214) exerts more
Marta Vuerich et al.
Journal of hepatology, 74(1), 48-57 (2020-07-15)
In autoimmune hepatitis (AIH), the imbalance between regulatory T cells (Tregs) and T-helper type 17 (Th17) cells has been linked to low levels of CD39, an ectoenzyme that hydrolyses ATP, ultimately generating immunosuppressive adenosine. Upregulation of CD39 results from activation
Laura MacPherson et al.
International journal of molecular sciences, 15(5), 7939-7957 (2014-05-09)
The aryl hydrocarbon receptor (AHR) regulates the toxic effects of 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD). The AHR repressor (AHRR) is an AHR target gene and functions as a ligand-induced repressor of AHR; however, its mechanism of inhibition is controversial. Recently, we reported that

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service