Skip to Content
Merck
All Photos(1)

Documents

EHU045911

Sigma-Aldrich

MISSION® esiRNA

targeting human MGP

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ACTGACCTGCAGGACGAAACCATGAAGAGCCTGATCCTTCTTGCCATCCTGGCCGCCTTAGCGGTAGTAACTTTGTGTTATGAATCACATGAAAGCATGGAATCTTATGAACTTAATCCCTTCATTAACAGGAGAAATGCAAATACCTTCATATCCCCTCAGCAGAGATGGAGAGCTAAAGTCCAAGAGAGGATCCGAGAACGCTCTAAGCCTGTCCACGAGCTCAATAGGGAAGCCTGTGATGACTACAGACTTTGCGAACGCTACGCCATGGTTTATGGATACAATGCTGCCTATAATCGCTACTTCAGGAAGCGCCGAGGGACCAAATGAGACTGAGGGAAGAAAAAAAATCTCTTTTTTTCTGGAGGCTGGCACCTGATTTTGTATCCCCCTGTAGCAGC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Mizhu Wang et al.
Molecular oncology, 14(5), 1045-1058 (2020-02-23)
Matrix Gla protein (MGP) has been widely reported as an extracellular matrix protein with abnormal expression in various types of cancer. However, the function of intracellular MGP in gastric cancer (GC) cells remains largely unknown. Here, we demonstrated aberrantly high
Changgeng Fu et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 51(4), 1739-1750 (2018-12-07)
Radix notoginseng is a well-known traditional Chinese herbal medicine, has extensively pharmacological activities in cardiovascular system. Notoginsenoside R1 (NGR1) is one main active ingredient of Radix notoginseng. The purpose of this study was to evaluate the functional effects of NGR1
Xueqing Li et al.
Molecular therapy oncolytics, 17, 371-383 (2020-05-15)
Matrix Gla protein (MGP), an extracellular matrix protein, is mainly associated with the inhibition of calcification in skeleton, coronary artery, and kidney, and more recently it has also been implicated in cancer. However, the biological function of MGP inside cancer

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service