Skip to Content
Merck
All Photos(1)

Documents

EHU033021

Sigma-Aldrich

MISSION® esiRNA

targeting human ZNF609

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AAACCAACAGCCCTGCATACTCTGACATCTCTGATGCTGGGGAGGATGGGGAGGGCAAGGTAGACAGTGTCAAATCAAAGGACGCCGAACAGTTGGTTAAAGAAGGGGCTAAGAAAACTCTTTTTCCCCCTCAGCCTCAGAGCAAAGACTCACCATATTACCAAGGCTTTGAGAGTTACTATTCTCCAAGTTATGCACAGTCCAGCCCTGGGGCTCTGAACCCCAGCAGCCAGGCAGGAGTGGAGAGCCAGGCCCTGAAGACAAAAAGGGATGAGGAACCTGAGAGCATAGAAGGGAAAGTGAAGAACGATATCTGTGAAGAAAAGAAGCCCGAGCTGAGCAGTTCCAGTCAGCAGCCCTCGGTCATCCAGCAGCGTCCCAATATGTACATGCAGTCCCTGTACTACAACCAGTATGCCTATGTACCCCCCTATGGCTACAGCGACCAGAGTTACCACACCCACCTTCTGAGCACT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

L Zhu et al.
European review for medical and pharmacological sciences, 23(7), 2817-2826 (2019-04-20)
This study aims to explore the biological function of circular RNA ZNF609 (circ-ZNF609) in regulating the occurrence and progression of nasopharyngeal carcinoma (NPC), and to investigate the possible underlying mechanism. The expression levels of circ-ZNF609, microRNA-150-5p and Sp1 in NPC
Yunhe Xiong et al.
Journal of cellular physiology, 234(7), 10646-10654 (2018-11-28)
Circular RNA (circRNA) play important roles in the pathological processes of many diseases. By analyzing the results of the GSE100186 chip, we found that the expression of circRNA ZNF609 (circ-ZNF609) was significantly increased in renal cell carcinoma. Recently, there are
Shaoxia Liu et al.
Journal of cellular physiology, 236(1), 79-92 (2021-01-19)
Circular RNAs (circRNAs) have been associated with lung cancer (LC), one of the most common cancers, but the underlying molecular mechanisms of the specific correlation with LC carcinogenesis remain unveiled. Quantitative real-time polymerase chain reaction was applied to examine the

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service