Skip to Content
Merck
All Photos(1)

Documents

EHU021051

Sigma-Aldrich

MISSION® esiRNA

targeting human MYC

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CAGATCAGCAACAACCGAAAATGCACCAGCCCCAGGTCCTCGGACACCGAGGAGAATGTCAAGAGGCGAACACACAACGTCTTGGAGCGCCAGAGGAGGAACGAGCTAAAACGGAGCTTTTTTGCCCTGCGTGACCAGATCCCGGAGTTGGAAAACAATGAAAAGGCCCCCAAGGTAGTTATCCTTAAAAAAGCCACAGCATACATCCTGTCCGTCCAAGCAGAGGAGCAAAAGCTCATTTCTGAAGAGGACTTGTTGCGGAAACGACGAGAACAGTTGAAACACAAACTTGAACAGCTACGGAACTCTTGTGCGTAAGGAAAAGTAAGGAAAACGATTCCTTCTAACAGAAATGTCCTGAGCAATCACCTATGAACTTGTTTCAAATGCATGATCAAATGCAACCTCACAACCTTGGCTGAG

Ensembl | human accession no.

ENSG00000136997

NCBI accession no.

NM_002467

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... MYC(4609) , MYC(4609)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Juanjuan Liu et al.
Annals of biomedical engineering, 45(6), 1407-1419 (2017-03-30)
Melanoma is a potentially lethal skin cancer with high mortality rate. Recently, the peptide-mediated transdermal delivery of small interference RNA (siRNA) emerges as a promising strategy to treat melanoma by inducing the apoptosis of tumor cells, but the related theoretical
Martina Godel et al.
International journal of molecular sciences, 21(12) (2020-07-01)
Doxorubicin (Dox) is one of the most important first-line drugs used in osteosarcoma therapy. Multiple and not fully clarified mechanisms, however, determine resistance to Dox. With the aim of identifying new markers associated with Dox-resistance, we found a global up-regulation
Feifei Zhang et al.
EBioMedicine, 44, 311-321 (2019-05-13)
Gastric cancer (GC) ranks the fifth most common cancer, and chemotherapy is one of the most common treatments for GC. However, chemoresistance limits the effectiveness of chemotherapy and leads to treatment failure. This study aims to investigate the biological effect
Xuyang Wang et al.
World journal of gastroenterology, 23(18), 3252-3261 (2017-06-02)
To determine the role of hepatitis B virus X protein (HBx), HBx in regulating hepatic progenitor cell (HPC)-like features in hepatocellular carcinoma (HCC) and the underlying molecular mechanisms. We used a retrovirus vector to introduce wild type HBx or empty
Lin Li et al.
Molecular therapy. Nucleic acids, 8, 169-183 (2017-09-18)
Highly specific and efficient delivery of siRNA is still unsatisfactory. Herein, a dual tumor-targeting siRNA delivery system combining pRNA dimers with chitosan nanoparticles (CNPPs) was designed to improve the specificity and efficiency of siRNA delivery. In this dual delivery system
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service