Skip to Content
Merck
All Photos(1)

Documents

EHU056991

Sigma-Aldrich

MISSION® esiRNA

targeting human CLOCK

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CGCACACATAGGCCATCTTATGAAGATAGAGTTTGTTTTGTAGCTACTGTCAGGTTAGCTACACCTCAGTTCATCAAGGAAATGTGCACTGTTGAAGAACCCAATGAAGAGTTTACATCTAGACATAGTTTAGAATGGAAGTTTCTGTTTCTAGATCACAGGGCACCACCCATAATAGGGTATTTGCCATTTGAAGTTCTGGGAACATCAGGCTATGATTACTATCATGTGGATGACCTAGAAAATTTGGCAAAATGTCATGAGCACTTAATGCAATATGGGAAAGGCAAATCATGTTATTATAGGTTCCTGACTAAGGGGCAACAGTGGATTTGGCTTCAGACTCATTATTATATCACTTACCATCAGTGGAATTCAAGGCCAGAGTTTATTGTTTGTACTCACACTGTAGTAAGTTATGCAGAAGTTAGGGCTGAAAGACGACG

Ensembl | human accession no.

ENSG00000134852

NCBI accession no.

NM_004898

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... CLOCK(9575) , CLOCK(9575)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Pan Jiang et al.
International journal of molecular medicine, 46(6), 2216-2224 (2020-10-31)
Circadian rhythm plays an important role in diverse physiological processes. Abnormal expression of circadian rhythm genes is associated with increased risk of disease, including different types of cancer. The cancer stem cell (CSC) hypothesis suggests that there is a small
Qixia Jiang et al.
Acta biochimica et biophysica Sinica, 50(9), 869-879 (2018-08-21)
To explore the association between clock circadian regulator circadian locomotor output cycles kaput gene (CLOCK) and the forming of atherosclerotic plaques and its underlying mechanisms, mouse aortic endothelial cells (MAECs) and atherosclerosis (AS) mouse model were recruited for our study.
Soon Young Shin et al.
Scientific reports, 7(1), 11175-11175 (2017-09-13)
The juice of Ageratum houstonianum is used in folk medicine as an external wound healing aid for skin injuries. However, the active component of A. houstonianum and its mode of action in skin wound healing has not been investigated. This
Ursula Loizides-Mangold et al.
Proceedings of the National Academy of Sciences of the United States of America, 114(41), E8565-E8574 (2017-10-05)
Circadian clocks play an important role in lipid homeostasis, with impact on various metabolic diseases. Due to the central role of skeletal muscle in whole-body metabolism, we aimed at studying muscle lipid profiles in a temporal manner. Moreover, it has
Laurent Perrin et al.
eLife, 7 (2018-04-17)
Circadian regulation of transcriptional processes has a broad impact on cell metabolism. Here, we compared the diurnal transcriptome of human skeletal muscle conducted on serial muscle biopsies in vivo with profiles of human skeletal myotubes synchronized in vitro. More extensive

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service