Skip to Content
Merck
All Photos(1)

Key Documents

EHU029361

Sigma-Aldrich

MISSION® esiRNA

targeting human SLC25A28

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CAGGAGTCCTTGGCTTTGAACTCACACATTACAGGACATATCACAGGCATGGCTAGTGCCTTCAGGACGGTATATCAAGTAGGTGGGGTGACCGCCTATTTCCGAGGGGTGCAGGCCAGAGTAATTTACCAGATCCCCTCCACAGCCATCGCATGGTCTGTGTATGAGTTCTTCAAATACCTAATCACTAAAAGGCAAGAAGAGTGGAGGGCTGGCAAGTGAAGTAGCACTGAACGAAGCCAGGGGTTCAGATGACACTGCTGCATCCTGGTCACATTCTCTGTCTCCTGGAATGCTCCCACCTCAAGTGGAGTTAGAAGGAAGGTAGAGGGGCTCTCCCCCAGGATTTTGGTGTTTTGACTAACACCAGTTCCTGCCAACCTCTGTTGCCACCACCTTTCCTTCCAGGCCCTAAG

Ensembl | human accession no.

ENSG00000155287

NCBI accession no.

NM_031212

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... SLC25A28(81894) , SLC25A28(81894)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Changfeng Li et al.
Developmental cell, 46(4), 441-455 (2018-08-14)
Pancreatic cancer is an aggressive malignancy with changes in the tumor microenvironment. Here, we demonstrate that PINK1 and PARK2 suppressed pancreatic tumorigenesis through control of mitochondrial iron-dependent immunometabolism. Using mouse models of spontaneous pancreatic cancer, we show that depletion of Pink1 and Park2
Chunlei Wang et al.
European journal of medical research, 19, 49-49 (2014-09-27)
Among glioma treatment strategies, arsenic trioxide (As2O3) has shown efficacy as a therapeutic agent against human gliomas. However, the exact antitumor mechanism of action of As2O3 is still unclear. Mitochondria are considered to be the major source of intracellular reactive
Zili Zhang et al.
Redox biology, 36, 101619-101619 (2020-08-31)
Ferroptosis is a recently discovered form of programmed cell death, but its regulatory mechanisms are not fully understood. In the current study, we reported that the BRD7-P53-SLC25A28 axis played a crucial role in regulating ferroptosis in hepatic stellate cells (HSCs).

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service