Skip to Content
Merck
All Photos(1)

Documents

EHU013881

Sigma-Aldrich

MISSION® esiRNA

targeting human TRIB3

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TCCAGAAACGAGCTCGAAGTGGGCCCCAGCCCAGACTGCCCCCCTGCCTGTTGCCCCTGAGCCCACCTACTGCTCCAGATCGTGCAACTGCTGTGGCCACTGCCTCCCGTCTTGGGCCCTATGTCCTCCTGGAGCCCGAGGAGGGCGGGCGGGCCTACCAGGCCCTGCACTGCCCTACAGGCACTGAGTATACCTGCAAGGTGTACCCCGTCCAGGAAGCCCTGGCCGTGCTGGAGCCCTATGCGCGGCTGCCCCCGCACAAGCATGTGGCTCGGCCCACTGAGGTCCTGGCTGGTACCCAGCTCCTCTACGCCTTTTTCACTCGGACCCATGGGGACATGCACAGCCTGGTGCGAAGCCGCCACCGTATCCCTGAGCCTGAGGCTGCCGTGCTCTTCCGCCAGATGGCCACCGCCCTGGCGCACTGTCACCAGCACGGTCTGGTCCTGCGTGATCTCAAGCTGTGTCGCTTTGTCTTCGCTGACCGTGAGAGGAAGAAGCTGGTGCTGGAGAA

Ensembl | human accession no.

ENSG00000101255

NCBI accession no.

NM_021158

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... TRIB3(57761) , TRIB3(57761)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Anna López-Plana et al.
International journal of cancer, 147(4), 1163-1179 (2020-01-17)
Around 40% of newly diagnosed lung cancer patients are Stage IV, where the improvement of survival and reduction of disease-related adverse events is the main goal for oncologists. In this scenario, we present preclinical evidence supporting the use of ABTL0812
Seong-Hoon Yun et al.
Oncotarget, 9(1), 495-511 (2018-02-09)
We previously demonstrated that the quinovose-containing hexaoside stichoposide C (STC) is a more potent anti-leukemic agent than the glucose-containing stichoposide D (STD), and that these substances have different molecular mechanisms of action. In the present study, we investigated the novel
Shuyi Wang et al.
Biochimica et biophysica acta, 1863(12), 3060-3074 (2017-09-25)
Endoplasmic reticulum (ER) stress has been demonstrated to prompt various cardiovascular risks although the underlying mechanism remains elusive. Protein tyrosine phosphatase-1B (PTP1B) serves as an essential negative regulator for insulin signaling. This study examined the role of PTP1B in ER
Xin Hu et al.
International journal of molecular sciences, 21(4) (2020-02-20)
NCAPG is a subunit of condensin I that plays a crucial role in chromatin condensation during mitosis. NCAPG has been demonstrated to be associated with farm animal growth traits. However, its role in regulating myoblast differentiation is still unclear. We
Yiteng Meng et al.
Digestive diseases and sciences, 64(8), 2167-2176 (2019-02-15)
The Tec kinase family is involved in acute and chronic inflammatory diseases, but its relationship with severe acute pancreatitis (SAP) remains unclear. To investigate whether Tec tyrosine kinase can be used as a target for severe acute pancreatitis-associated acute lung
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service