Skip to Content
Merck
All Photos(1)

Key Documents

EHU122951

Sigma-Aldrich

MISSION® esiRNA

targeting human DYRK2

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCCTTCGAACACCATGAGATTTTCAGCTACCCTGAAATATATTTCTTGGGTCTAAATGCTAAGAAGCGCCAGGGCATGACAGGTGGGCCCAACAATGGTGGCTATGATGATGACCAGGGATCATATGTGCAGGTGCCCCACGATCACGTGGCTTACAGGTATGAGGTCCTCAAGGTCATTGGGAAGGGGAGCTTTGGGCAGGTGGTCAAGGCCTACGATCACAAAGTCCACCAGCACGTGGCCCTAAAGATGGTGCGGAATGAGAAGCGCTTCCACCGGCAAGCAGCGGAGGAGATCCGAATCCTGGAACACCTGCGGAAGCAGGACAAGGATAACACAATGAATGTCATCCATATGCTGGAGAATTTCACCTTCCGCAACCACATCTGCATGACGTTTGAGCTGCTGAGCATGA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Not finding the right product?  

Try our Product Selector Tool.

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Takenori Yamamoto et al.
FEBS letters, 591(6), 842-853 (2017-02-15)
The genome of eukaryotic cells is frequently exposed to damage by various genotoxins. Phosphorylation of histone H2AX at Serine 139 (γ-H2AX) is a hallmark of DNA damage. RNF8 monoubiquitinates γ-H2AX with the Lys63-linked ubiquitin chain to tether DNA repair molecules
Saishu Yoshida et al.
eLife, 9 (2020-08-08)
Mammalian Hedgehog (Hh) signaling plays key roles in embryogenesis and uniquely requires primary cilia. Functional analyses of several ciliogenesis-related genes led to the discovery of the developmental diseases known as ciliopathies. Hence, identification of mammalian factors that regulate ciliogenesis can

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service