Skip to Content
Merck
All Photos(1)

Key Documents

EHU065431

Sigma-Aldrich

MISSION® esiRNA

targeting human KEAP1

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ATCGATGGCCACATCTATGCCGTCGGCGGCTCCCACGGCTGCATCCACCACAACAGTGTGGAGAGGTATGAGCCAGAGCGGGATGAGTGGCACTTGGTGGCCCCAATGCTGACACGAAGGATCGGGGTGGGCGTGGCTGTCCTCAATCGTCTCCTTTATGCCGTGGGGGGCTTTGACGGGACAAACCGCCTTAATTCAGCTGAGTGTTACTACCCAGAGAGGAACGAGTGGCGAATGATCACAGCAATGAACACCATCCGAAGCGGGGCAGGCGTCTGCGTCCTGCACAACTGTATCTATGCTGCTGGGGGCTATGATGGTCAGGACCAGCTGAACAGCGTGGAGCGCTACGATGTGGAAACAGAGACGTGGACTTTCGTAGCCCCCATGAAGCACCGGCGAAGTGCCCTGGGGATCACTGTCCACCAGGGGAGAATCTACGTCCTTGGAGGCTATGATGGTCACA

Ensembl | human accession no.

ENSG00000079999

NCBI accession no.

NM_012289

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... KEAP1(9817) , KEAP1(9817)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Jing-Lei Yang et al.
Aging, 12(11), 10370-10380 (2020-06-03)
In cultured human umbilical vein endothelial cells (HUVECs) high glucose (HG) stimulation will lead to significant cell death. Bardoxolone-methyl (BARD) is a NF-E2 p45-related factor 2 (Nrf2) agonist. In this study we show that BARD, at only nM concentrations, activated
Min-Kyun Song et al.
Free radical biology & medicine, 138, 33-42 (2019-05-07)
Transforming growth factor-β (TGF-β) is a potent pathogenic factor of renal injury through the upregulation of extracellular matrix (ECM) expression and facilitation of renal fibrosis. Nuclear factor erythroid 2-like 2 (Nfe2l2; Nrf2), a master regulator of antioxidant and detoxifying systems
Min Cai et al.
Anesthesiology, 126(3), 507-521 (2017-01-04)
The authors have reported that antioxidative effects play a crucial role in the volatile anesthetic-induced neuroprotection. Accumulated evidence shows that endogenous antioxidation could be up-regulated by nuclear factor-E2-related factor 2 through multiple pathways. However, whether nuclear factor-E2-related factor 2 activation
Nan Chen et al.
Journal of cellular physiology, 235(10), 7204-7213 (2020-02-06)
Diabetic retinopathy (DR) is a leading cause of acquired blindness among adults. High glucose (HG) induces oxidative injury and apoptosis in retinal ganglion cells (RGCs), serving as a primary pathological mechanism of DR. MIND4-17 activates nuclear-factor-E2-related factor 2 (Nrf2) signaling
Zhenzi Bai et al.
Gut pathogens, 12, 22-22 (2020-04-30)
Emerging evidence closely links Enterovirus 71 (EV71) infection with the generation of reactive oxygen species (ROS). Excess ROS results in apoptosis and exacerbates inflammatory reactions. The Keap1-Nrf2 axis serves as an essential oxidant counteracting pathway. The present study aimed to
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service