Skip to Content
Merck
All Photos(1)

Documents

EHU081471

Sigma-Aldrich

MISSION® esiRNA

targeting human NR1I2

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGTGTCTCTGCATCCATTTGAACACATTATTAAGCACCGATAATAGGTAGCCTGCTGTGGGGTATACAGCATTGACTCAGATATAGATCCTGAGCTCACAGAGTTTATAGTTAAAAAAACAAACAGAAACACAAACGATTTGGATCAAAAGGAGAAATGATAAGTGACAAAAGCAGCACAAGGAATTTCCCTGTGTGGATGCTGAGCTGTGATGGCGGGCACTGGGTACCCAAGTGAAGGTTCCCAAGGACATGAGTCTGTAGGAGCAAGGGCACAAACTGCAGCTGTGAGTGCGTGTGTGTGATTTGGTGTAGGTAGGTCTGTTTGCCACTTGATGGGGCCTGGGTTTGTTCCTGGGGCTGGAATGCTGGGTATGCTCTGTGACAAGGCTACGCTGACAATCA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Wenjing Luo et al.
British journal of pharmacology, 174(8), 700-717 (2017-01-28)
Imatinib mesylate (IM) is a first-line treatment for chronic myeloid leukaemia (CML) as a specific inhibitor of BCR-ABL tyrosine kinase. As IM is widely used in CML, in combination with other drugs, the effects of IM on drug-metabolizing enzymes (DMEs)
Omozuanvbo Aisiku et al.
Blood, 125(12), 1976-1985 (2015-01-15)
Protease-activated receptor-1 (PAR1) couples the coagulation cascade to platelet activation during myocardial infarction and to endothelial inflammation during sepsis. This receptor demonstrates marked signaling bias. Its activation by thrombin stimulates prothrombotic and proinflammatory signaling, whereas its activation by activated protein
Yiqiang Xie et al.
Pakistan journal of pharmaceutical sciences, 31(5(Special)), 2315-2321 (2018-11-23)
Feng-Liao-Chang-Wei-Kang (FLCWK), a traditional Chinese patent medicine, consists primarily of Polygonum hydropiper and Daphniphyllum calycinum roots. As a complex containing several kinds of flavonoids, FLCWK has the potential to impact the drug metabolism enzyme P450 3A4 (CYP3A4) and nuclear receptors.
M Semeniuk et al.
Archives of toxicology, 94(5), 1625-1635 (2020-03-19)
P-glycoprotein (P-gp) is an ABC transporter exhibiting high pharmacotoxicological relevance by extruding a wide range of cytotoxic compounds out of the cells. Previously, we demonstrated that the phytoestrogen genistein (GNT) modulates P-gp expression in hepatocellular carcinoma in vitro. Although several
Yan Chen et al.
Cancer medicine, 5(12), 3564-3571 (2016-11-24)
Cytochrome P450 2C8 (CYP2C8) is one of the enzymes that primarily participate in producing metabolisms of medications and P-glycoprotein (P-gp) has been regarded as one of the important molecules in chemotherapeutically induced multidrug resistance (MDR). In addition, the pregnane X

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service