Skip to Content
Merck
All Photos(1)

Key Documents

EMU178411

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Stim2

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGGACCGTGGCTAAACCTGCAGGATCTTTAGCCAGAAGCAGTAGTTTATGCCGCTCTCGTCGCAGCATCGTGCCATCCTCCCCACAGTCTCAGCGAGCTCAGCTTCCTGCTCATGCTCCTCTGGCAGCCCACCCTCGGCACCCTCACCATCCGCAGCATCCCCAGCACTCGTTGCCTTCCCCAGATCCAGACATCCTGTCTGTGTCAAGTTGCCCTGCTCTGTATCGGAACGAAGAGGAGGAGGAGGCTATCTACTTCACTGCTGAGAAACAATGGGAAGTGCCAGACACAGCTTCAGAATGTGACTCCTTAAACTCTTCCAGTGGGAGAAAACCGTCTCCCCCTTCAAGCCTTGAGATGTACCAAACATTGTCTTCCCGAAAAATCTCAAGAGACGAGCTTTCCCTGGAGGACTCTTCCAGGGGGGAGTCACCCGTGACAGCAGATGTCTCCCGGGGCTCCCCTGAGTGTGTGGGTCTGACGGAGACCAAGAGCATGATCTTCAGCCCTGCAAG

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Ruby A Fernandez et al.
American journal of physiology. Cell physiology, 308(8), C581-C593 (2015-02-13)
Pulmonary arterial hypertension (PAH) is a progressive disease that, if left untreated, eventually leads to right heart failure and death. Elevated pulmonary arterial pressure (PAP) in patients with PAH is mainly caused by an increase in pulmonary vascular resistance (PVR).
Raz Palty et al.
Cell research, 25(8), 963-980 (2015-07-04)
Calcium flux through store-operated calcium entry is a major regulator of intracellular calcium homeostasis and various calcium signaling pathways. Two key components of the store-operated calcium release-activated calcium channel are the Ca(2+)-sensing protein stromal interaction molecule 1 (STIM1) and the
Jingsheng Xia et al.
The Journal of physiology, 592(16), 3443-3461 (2014-05-27)
Store-operated calcium channels (SOCs) are calcium-selective cation channels that mediate calcium entry in many different cell types. Store-operated calcium entry (SOCE) is involved in various cellular functions. Increasing evidence suggests that impairment of SOCE is responsible for numerous disorders. A

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service