Skip to Content
Merck
All Photos(1)

Key Documents

EHU155811

Sigma-Aldrich

MISSION® esiRNA

targeting human FOXA1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GACTCCAGCCTCCTCAACTGCGCCCCCCATAAGCTCCGGGCCCGGGGCGCTGGCCTCTGTGCCCGCCTCTCACCCGGCACACGGCTTGGCACCCCACGAGTCCCAGCTGCACCTGAAAGGGGACCCCCACTACTCCTTCAACCACCCGTTCTCCATCAACAACCTCATGTCCTCCTCGGAGCAGCAGCATAAGCTGGACTTCAAGGCATACGAACAGGCACTGCAATACTCGCCTTACGGCTCTACGTTGCCCGCCAGCCTGCCTCTAGGCAGCGCCTCGGTGACCACCAGGAGCCCCATCGAGCCCTCAGCCCTGGAGCCGGCGTACTACCAAGGTGTGTATTCCAGACCCGTCCTAAACACTTCCTAGCTCCCGGGACTGGGGGGTTTGTCTGGCATAGCCAT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Shixiong Wang et al.
International journal of molecular sciences, 19(12) (2018-12-24)
Forkhead box A1 (FOXA1) belongs to the forkhead class transcription factor family, playing pioneering function for hormone receptors in breast and prostate cancers, and mediating activation of linage specific enhancers. Interplay between FOXA1 and breast cancer specific signaling pathways has
Erina Anzai et al.
Biological & pharmaceutical bulletin, 40(9), 1483-1489 (2017-09-05)
Epithelial-to-mesenchymal transition (EMT) is an important process during embryonic development and tumor progression by which adherent epithelial cells acquire mesenchymal properties. Forkhead box protein A1 (FOXA1) is a transcriptional regulator preferentially expressed in epithelial breast cancer cells, and its expression
Shijun Lu et al.
Inflammation research : official journal of the European Histamine Research Society ... [et al.], 69(7), 645-656 (2020-04-29)
Nowadays, sepsis-induced acute kidney injury (AKI) has gradually become a global problem for its high incidence and increasing mortality. Previous study has reported lncRNA ENST00000452391.1 in sepsis patients. However, its potential biological function and downstream molecular mechanism are still mysterious.
Suzie K Hight et al.
Neoplasia (New York, N.Y.), 22(8), 294-310 (2020-06-09)
Using a mini-library of 1062 lentiviral shRNAs targeting 40 nuclear hormone receptors and 70 of their co-regulators, we searched for potential therapeutic targets that would be important during in vivo tumor growth using a parallel in vitro and in vivo
Yeqing A Yang et al.
Nucleic acids research, 44(17), 8153-8164 (2016-06-04)
Forkhead box A1 (FOXA1) is an FKHD family protein that plays pioneering roles in lineage-specific enhancer activation and gene transcription. Through genome-wide location analyses, here we show that FOXA1 expression and occupancy are, in turn, required for the maintenance of

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service