Skip to Content
Merck
All Photos(1)

Key Documents

EHU111091

Sigma-Aldrich

MISSION® esiRNA

targeting human XIAP

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCATGGCAGATTATGAAGCACGGATCTTTACTTTTGGGACATGGATATACTCAGTTAACAAGGAGCAGCTTGCAAGAGCTGGATTTTATGCTTTAGGTGAAGGTGATAAAGTAAAGTGCTTTCACTGTGGAGGAGGGCTAACTGATTGGAAGCCCAGTGAAGACCCTTGGGAACAACATGCTAAATGGTATCCAGGGTGCAAATATCTGTTAGAACAGAAGGGACAAGAATATATAAACAATATTCATTTAACTCATTCACTTGAGGAGTGTCTGGTAAGAACTACTGAGAAAACACCATCACTAACTAGAAGAATTGATGATACCATCTTCCAAAATCCTATGGTACAAGAAGCTATACGAATGGGGTTCAGTTTCAAGGACATTAAGAAAATAATGGAGGAAAAAATTCAGATATCTGGGAGCAACTATAAATCACTTGAGGTTCTGGTTGCA

Ensembl | human accession no.

ENSG00000101966

NCBI accession no.

NM_001167

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... XIAP(331) , XIAP(331)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Ying Hou et al.
Journal of cell science, 130(2), 502-511 (2016-12-09)
Regulation of cell death is crucial for the response of cancer cells to drug treatments that cause arrest in mitosis, and is likely to be important for protection against chromosome instability in normal cells. Prolonged mitotic arrest can result in
Morikazu Miyamoto et al.
Anticancer research, 38(1), 301-306 (2017-12-27)
To investigate whether XIAP down-regulation and autophagy inhibition sensitize ovarian clear cell cancer cells to cisplatin. The ovarian clear cancer cell line KK was used for in vitro analysis. Hydroxychloroquine (HCQ) and phenoxodiol (PXD) or embelin were used as autophagy
Rachel Coyle et al.
International journal of oncology, 55(1), 191-202 (2019-05-23)
Malignant rhabdoid tumour (MRT) is a rare, aggressive paediatric neoplasm, primarily diagnosed in those below the age of three. MRTs most commonly arise in the central nervous system and kidneys. A poor prognosis accompanies the MRT diagnosis, with a reported
Mehdi Agha Gholizadeh et al.
Cell & bioscience, 10, 78-78 (2020-06-17)
The X-linked inhibitor of apoptosis protein (XIAP) is the most potent caspase inhibitor of the IAP family in apoptosis pathway. This study aims to identify the molecular targets of XIAP in human breast cancer cells exposed to XIAP siRNA by
Ke Ren et al.
Pathology oncology research : POR, 25(1), 341-348 (2017-11-11)
To find the exact downstream effector of Pim-2 pathway in prostate cancer cells, and to determine the means by which it affects prostate cancer. XIAP, Pim-2 and p-eIF4B expressions were detected in PCA and BPH tissues. Then the Pim-2 and
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service