Skip to Content
Merck
All Photos(1)

Key Documents

EHU105981

Sigma-Aldrich

MISSION® esiRNA

targeting human BMPR1A

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGCAAGAGCATCTCAAGCAGACGTCGTTACAATCGTGATTTGGAACAGGATGAAGCATTTATTCCAGTTGGAGAATCACTAAAAGACCTTATTGACCAGTCACAAAGTTCTGGTAGTGGGTCTGGACTACCTTTATTGGTTCAGCGAACTATTGCCAAACAGATTCAGATGGTCCGGCAAGTTGGTAAAGGCCGATATGGAGAAGTATGGATGGGCAAATGGCGTGGCGAAAAAGTGGCGGTGAAAGTATTCTTTACCACTGAAGAAGCCAGCTGGTTTCGAGAAACAGAAATCTACCAAACTGTGCTAATGCGCCATGAAAACATACTTGGTTTCATAGCGGCAGACATTAAAGGTACAGGTTCCTGGACTCAGCTCTATTTGATTACTGATTACCATGAAAATGGATCTCTCTATGACTTCCTGAAATGTGCTACACTGGACACCAGAGCCCTGCTTAAATTGGCTTATTCAGCTGCCTGTGGTCTGTGCCACCTGCACACAGAAATTTATGGCACCCAAGGAAAG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Not finding the right product?  

Try our Product Selector Tool.

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Wencai Shi et al.
Biological trace element research, 176(2), 294-304 (2016-09-24)
Hepcidin synthesis is reported to be inadequate according to the body iron store in patients with non-alcoholic fatty liver disease (NAFLD) undergoing hepatic iron overload (HIO). However, the underlying mechanisms remain unclear. We hypothesize that hepatocyte nuclear factor-4α (HNF-4α) may
Zhixian Yu et al.
PloS one, 11(12), e0168334-e0168334 (2016-12-16)
Approximately 30% of tumor endothelial cells have over-duplicated (>2) centrosomes, which may contribute to abnormal vessel function and drug resistance. Elevated levels of vascular endothelial growth factor A induce excess centrosomes in endothelial cells, but how other features of the
Mian Guo et al.
Carcinogenesis, 35(8), 1698-1706 (2014-02-01)
Bone morphogenetic protein-2 (BMP-2), a member of the transforming growth factor-β family, plays critical roles in cell differentiation, modeling and regeneration processes in several tissues. BMP-2 is also closely associated with various malignant tumors. microRNAs negatively and posttranscriptionally regulate gene

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service