Skip to Content
Merck
All Photos(1)

Key Documents

EHU063491

Sigma-Aldrich

MISSION® esiRNA

targeting human ELAVL1

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCGTCACCAATGTGAAAGTGATCCGCGACTTCAACACCAACAAGTGCAAAGGGTTTGGCTTTGTGACCATGACAAACTATGAAGAAGCCGCGATGGCCATAGCCAGCCTGAACGGCTACCGCCTGGGGGACAAAATCTTACAGGTTTCCTTCAAAACCAACAAGTCCCACAAATAACTCGCTCATGCTTTTTTTTGTACGGAATAGATAATTAAGAGTGAAGGAGTTGAAACTTTTCTTGTTAGTGTACAACTCATTTTGCGCCAATTTTCACAAGTGTTTGTCTTTGTCTGAATGAGAAGTGAGAAGGTTTTTATACTCTGGGATGCAACCGACATGTTCAAATGTTTGAAATCCCACAATGTTAGACCAATCTTAAGTTTCGTAAGTTATTTCCTTTAAGATATATATTAAACAGAAATCTAAGTAGAACTGCATTGACTAACCAGTCCCTCTGGATGGTGGTGAACCT

Ensembl | human accession no.

ENSG00000066044

NCBI accession no.

NM_001419

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... ELAVL1(1994) , ELAVL1(1994)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Guillaume Gauchotte et al.
The Journal of pathology, 242(4), 421-434 (2017-05-12)
HuR regulates cytoplasmic mRNA stability and translatability, and the HuR expression level has been shown to correlate with poor disease outcome in several cancer types; however, the prognostic value and potential pro-oncogenic properties of HuR in meningioma remain unclear. Thus
Aya Yanagawa-Matsuda et al.
Oncology reports, 41(2), 954-960 (2018-11-16)
AU-rich elements (AREs) are RNA elements that enhance the rapid decay of mRNA. The fate of ARE-mRNA is controlled by ARE-binding proteins. HuR, a member of the embryonic lethal abnormal vision (ELAV) family of RNA-binding proteins, is involved in the
Shuran Li et al.
Science China. Life sciences, 60(6), 617-626 (2017-06-25)
APOBEC3 protein families, a DNA cytidine deaminase, were up-regulated in multiple tumors. However, the relationship between Hepatocellular carcinoma (HCC) and APOBEC3B (A3B) remains unknown. It has been confirmed that interleukin-6 (IL-6) has significant impacts on oncogenesis of HCC. Here, we
Sun Kyoung Lee et al.
Scientific reports, 7(1), 9610-9610 (2017-08-31)
Breast cancer mainly spreads to bone, causing decreased survival of patient. Human antigen R (HuR) and chemokines are important molecules associated with mRNA stability and cell-cell interaction in cancer biology. Here, HuR knockdown inhibited bone metastasis and osteolysis of metastatic
Prachi Matsye et al.
Glia, 65(6), 945-963 (2017-03-17)
In neurodegenerative diseases such as amyotrophic lateral sclerosis (ALS), chronic activation of microglia contributes to disease progression. Activated microglia produce cytokines, chemokines, and other factors that normally serve to clear infection or damaged tissue either directly or through the recruitment
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service