Skip to Content
Merck
All Photos(1)

Key Documents

EHU052231

Sigma-Aldrich

MISSION® esiRNA

targeting human CLCN7

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGGATCTCTCAGGGAAGGTCAACGTCACTGAAACGAGATTTCAAGATCTTCGAGTACTTCCGCAGAGACACAGAGAAGCGGGACTTCGTCTCCGCAGGGGCTGCGGCCGGAGTGTCAGCGGCGTTTGGAGCCCCCGTGGGTGGGGTCCTGTTCAGCTTGGAGGAGGGTGCGTCCTTCTGGAACCAGTTCCTGACCTGGAGGATCTTCTTTGCTTCCATGATCTCCACGTTCACCCTGAATTTTGTTCTGAGCATTTACCACGGGAACATGTGGGACCTGTCCAGCCCAGGCCTCATCAACTTCGGAAGGTTTGACTCGGAGAAAATGGCCTACACGATCCACGAGATCCCGGTCTTCATCGCCATGGGCGTGGTGGGCGGTGTGCTTGGAGCAGTGTTCAA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Not finding the right product?  

Try our Product Selector Tool.

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Ju-Hyun Lee et al.
Journal of molecular biology, 432(8), 2633-2650 (2020-02-28)
Lysosomal dysfunction is considered pathogenic in Alzheimer disease (AD). Loss of presenilin-1 (PSEN1) function causing AD impedes acidification via defective vacuolar ATPase (vATPase) V0a1 subunit delivery to lysosomes. We report that isoproterenol (ISO) and related β2-adrenergic agonists reacidify lysosomes in
Takashi Kurita et al.
Molecular pharmacology, 88(1), 113-120 (2015-05-07)
Articular chondrocytes in osteoarthritis (OA) patients are exposed to hypoosmotic stress because the osmolality of this synovial fluid is significantly decreased. Hypoosmotic stress can cause an efflux of Cl(-) and an associated decrease of cell volume. We have previously reported

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service