Skip to Content
Merck
All Photos(1)

Key Documents

EHU050541

Sigma-Aldrich

MISSION® esiRNA

targeting human FSCN1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ACCTGTCTGCCAATCAGGACGAGGAGACCGACCAGGAGACCTTCCAGCTGGAGATCGACCGCGACACCAAAAAGTGTGCCTTCCGTACCCACACGGGCAAGTACTGGACGCTGACGGCCACCGGGGGCGTGCAGTCCACCGCCTCCAGCAAGAATGCCAGCTGCTACTTTGACATCGAGTGGCGTGACCGGCGCATCACACTGAGGGCGTCCAATGGCAAGTTTGTGACCTCCAAGAAGAATGGGCAGCTGGCCGCCTCGGTGGAGACAGCAGGGGACTCAGAGCTCTTCCTCATGAAGCTCATCAACCGCCCCATCATCGTGTTCCGCGGGGAGCATGGCTTCATCGGCTGCCGCAAGGTCACGGGCACCCTGGACGCCAACCGCTCCAGCTATGACGTCTTCCAGCTGGAGTTCAACGATGGCGCCTACAACATCAAAGACTCCACAGGCA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Not finding the right product?  

Try our Product Selector Tool.

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Wei Gao et al.
Molecular therapy : the journal of the American Society of Gene Therapy, 27(2), 365-379 (2018-10-21)
Laryngeal squamous cell carcinoma (LSCC) is a common form of head and neck cancer with poor prognosis. However, the mechanism underlying the pathogenesis of LSCC remains unclear. Here, we demonstrated increased expression of fascin actin-bundling protein 1 (FSCN1) and decreased
Priscila Campioni Rodrigues et al.
Oncotarget, 8(43), 74736-74754 (2017-11-02)
Oral squamous cell carcinoma (OSCC) prognosis is related to clinical stage and histological grade. However, this stratification needs to be refined. We conducted a comparative proteome study in microdissected samples from normal oral mucosa and OSCC to identify biomarkers for
Sean McGuire et al.
Gynecologic oncology, 153(2), 405-415 (2019-02-25)
Ovarian cancer (OvCa) metastasis requires the coordinated motility of both cancer and stromal cells. Cellular movement is a dynamic process that involves the synchronized assembly of f-actin bundles into cytoskeletal protrusions by fascin. Fascin directly binds f-actin and is an
Aihua Luo et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 73, 75-79 (2015-07-28)
Fascin actin-bundling protein 1 (FSCN1) plays significant roles in biological processes such as tumor cell invasion and metastasis. However, little is known about prognostic value of FSCN1 in non-small cell lung cancer (NSCLC). FSCN1 mRNA and protein expression were detected
Jia-jia Chen et al.
PloS one, 10(5), e0126890-e0126890 (2015-05-27)
MicroRNAs (miRs) play important roles in modulating gene expression during the processes of tumorigenesis and tumor development. Previous studies have found that miR-145 is down-regulated in the stomach neoplasm and is related to tumor migration and invasion. However, both the

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service