Skip to Content
Merck
All Photos(1)

Key Documents

View All Documentation

EHU016751

Sigma-Aldrich

MISSION® esiRNA

targeting human CTGF

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTGCACCAGCATGAAGACATACCGAGCTAAATTCTGTGGAGTATGTACCGACGGCCGATGCTGCACCCCCCACAGAACCACCACCCTGCCGGTGGAGTTCAAGTGCCCTGACGGCGAGGTCATGAAGAAGAACATGATGTTCATCAAGACCTGTGCCTGCCATTACAACTGTCCCGGAGACAATGACATCTTTGAATCGCTGTACTACAGGAAGATGTACGGAGACATGGCATGAAGCCAGAGAGTGAGAGACATTAACTCATTAGACTGGAACTTGAACTGATTCACATCTCATTTTTCCGTAAAAATGATTTCAGTAGCACAAGTTATTTAAATCTGTTTTTCTAACTGGGGGAAAAGATTCCCACCCAATTCAAAACATTGTGCCATGTCAAACAAATAGTCTATCAACCCCAGACACTGGTTTGAAGAATGTTAAGACTTGACAGTGGAACTACATTAGTACACAGCACCAGAATGTATATTAAGGTGTGGCTTTAGGAGCA

Ensembl | human accession no.

ENSG00000118523

NCBI accession no.

NM_001901

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... CTGF(1490) , CTGF(1490)

Related Categories

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Arunachal Chatterjee et al.
PloS one, 12(12), e0190217-e0190217 (2017-12-30)
Perspectives on whether the functions of MAS, a G protein-coupled receptor, are beneficial or deleterious in the heart remain controversial. MAS gene knockout reduces coronary vasodilatation leading to ischemic injury. G protein signaling activated by MAS has been implicated in
Jung-Chien Cheng et al.
Oncotarget, 8(49), 85224-85233 (2017-11-22)
Ovarian low-grade serous carcinoma (LGSC) is a rare disease and is now considered to be a distinct entity from high-grade serous carcinoma (HGSC), which is the most common and malignant form of epithelial ovarian cancer. Connective tissue growth factor (CTGF)
Hiroshi Kinashi et al.
Scientific reports, 9(1), 12175-12175 (2019-08-23)
Lymphatic absorption in the peritoneal cavity may contribute to ultrafiltration failure in peritoneal dialysis (PD). Lymphatic vessels develop during PD-related peritoneal fibrosis. Connective tissue growth factor (CTGF, also called CCN2) is an important determinant of fibrotic tissue remodeling, but little
Kai Yang et al.
OncoTargets and therapy, 9, 7285-7295 (2016-12-13)
Colorectal cancer (CRC) is one of the most commonly diagnosed cancers among both males and females; the chemotherapy drug 5-fluorouracil (5-FU) is one of a doctors' first lines of defense against CRC. However, therapeutic failures are common because of the
Erika Gucciardo et al.
International journal of molecular sciences, 19(12) (2018-12-16)
Diabetic retinopathy (DR) is the most common diabetic microvascular complication and major cause of blindness in working-age adults. According to the level of microvascular degeneration and ischemic damage, DR is classified into non-proliferative DR (NPDR), and end-stage, proliferative DR (PDR).
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service