Skip to Content
Merck
All Photos(1)

Key Documents

EMU203261

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Socs1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TCTGCTGTGCAGAATATCCTATTTTATATTTTTACAGCCAGTTTAGGTAATAAACTTTATTATGAAAGTTTTTTTTTAAAAGAAACAAAGATTCCTAGAGCGTATGCTTTGGCCAAACGTCCTGGGTTGGGAGTGGGGTATACAGACTGACTTTTCTTGAAGTCTTCGGGATGCTGGGGGGAGGGGGGAGGGTCGGACATCATATACATCTCCACCCACAGTGATGGGGACCAAACTTCCAGGCTAGTTGTGGTTTATGACTGGGAAGATGGCCGCTCCTGAGTATCCGTGCCTGGTCTCTGGTATTTCTGTGATGGGATCCTACAGGGACAGCCCCTGACACTGAGTACTGTGTTGCCCCCAGTATACAGAGGAGAAAACTGAGAGACGGGTAATTGACGACAGACCATTCCTGGACTGGAGAGGTGGGCCTTTTAACTGTCCATCCTGCATCAATTTGAAATGGATGACAGAGAGGAAACTTCTTTGCTTCTCTGACCACAACTACTTCCAGGA

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Hua-Bing Li et al.
Nature, 548(7667), 338-342 (2017-08-10)
N
Gang Xu et al.
Virology, 462-463, 343-350 (2014-07-16)
MiR-221 was reported to be upregulated and play roles in tumorigenesis of hepatitis C virus (HCV) associated hepatocellular carcinoma (HCC). However, the role of miR-221 in HCV infection remains unknown. In this study, it was found that miR-221 was upregulated
Wai Po Chong et al.
Immunity, 53(2), 384-397 (2020-07-17)
Dysregulated Th17 cell responses underlie multiple inflammatory and autoimmune diseases, including autoimmune uveitis and its animal model, EAU. However, clinical trials targeting IL-17A in uveitis were not successful. Here, we report that Th17 cells were regulated by their own signature
Chulwon Kim et al.
Oncotarget, 6(6), 4020-4035 (2015-03-05)
Artesunate (ART), a semi-synthetic derivative of artemisinin, is one of the most commonly used anti-malarial drugs. Also, ART possesses anticancer potential albeit through incompletely understood molecular mechanism(s). Here, the effect of ART on various protein kinases, associated gene products, cellular

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service