Skip to Content
Merck
All Photos(1)

Key Documents

EMU061651

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Ccne1

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GATGGAGGTGTGCGAAGTCTATAAGCTCCACAGAGAGACGTTCTACTTGGCACAGGACTTCTTTGATCGTTACATGGCATCACAACAGAATATCATAAAAACACTTTTACAGCTTATTGGGATTTCAGCCTTATTTATTGCTTCAAAACTTGAGGAAATCTACCCTCCAAAGTTGCACCAGTTTGCTTATGTTACAGATGGCGCTTGCTCCGGGGATGAAATTCTTACCATGGAATTGATGATGATGAAGGCCCTTAAGTGGCGTCTAAGCCCTCTGACCATTGTGTCCTGGCTGAATGTCTATGTCCAAGTGGCCTATGTCAACGACACGGGTGAGGTGCTGATGCCTCAGTACCCACAGCAGGTCTTCGTGCAGATCGCAGAGCTTCTAGACCTGTGCGTCC

Ensembl | mouse accession no.

ENSMUSG00000002068

NCBI accession no.

NM_007633

shipped in

ambient

storage temp.

−20°C

Gene Information

mouse ... CCNE1(12447) , Ccne1(12447)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Zhiyuan Han et al.
Oncotarget, 6(15), 13149-13163 (2015-04-25)
Cyclin E1, encoded by the CCNE1 gene, promotes G1/S transition, chromosome instability, and oncogenesis. Here, we show that miR-497 and miR-34a target the 3'-UTR of CCNE1. miR-497 and miR-34a are downregulated in cancer cells and their ectopic expression inhibited cell
Xiaoyang Xu et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 37(2), 419-431 (2015-09-01)
The accumulation of free cholesterol in atherosclerotic lesions has been well documented in both animals and humans. In studying the relevance of free cholesterol buildup in atherosclerosis, contradictory results have been generated, indicating that free cholesterol produces both pro- and
Ning-Ai Liu et al.
The Journal of clinical endocrinology and metabolism, 100(7), 2557-2564 (2015-05-06)
Cushing disease, due to pituitary corticotroph tumor ACTH hypersecretion, drives excess adrenal cortisol production with adverse morbidity and mortality. Loss of glucocorticoid negative feedback on the hypothalamic-pituitary-adrenal axis leads to autonomous transcription of the corticotroph precursor hormone proopiomelanocortin (POMC), consequent

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service