Skip to Content
Merck
All Photos(1)

Key Documents

EHU142761

Sigma-Aldrich

MISSION® esiRNA

targeting human KAT2A

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCTGACCACGTATCCCACTTGGAGAATGTGTCAGAGGATGAGATAAACCGACTGCTGGGGATGGTGGTGGATGTGGAGAATCTCTTCATGTCTGTTCACAAGGAAGAGGACACAGACACCAAGCAGGTCTATTTCTACCTCTTCAAGCTACTGCGGAAATGCATCCTGCAGATGACCCGGCCTGTGGTGGAGGGGTCCCTGGGCAGCCCTCCATTTGAGAAACCTAATATTGAGCAGGGTGTGCTGAACTTTGTGCAGTACAAGTTTAGTCACCTGGCTCCCCGGGAGCGGCAGACGATGTTCGAGCTCTCAAAGATGTTCTTGCTCTGCCTTAACTACTGGAAGCTTGAGACACCTGCCCAGTTTCGGCAGAGGTCTCAGGCTGAGGACGTGGCTACCTACAAGGTCAATTACACCAGATGGCTCTGTTACTGCCACGTGCCCCAGAGCTGTGATAGCCTCCCCCGCTACGAAACCACTCATGTCTTTGGGC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Liming Zhao et al.
Oncology letters, 16(3), 3955-3963 (2018-08-22)
Histone acetyltransferase GCN5 is a critical component of the TGF-β/Smad signaling pathway in breast cancer cells; however, it remains unknown whether it is involved in the development and progression of breast cancer. The present study investigated the role of GCN5
Lijun Qiao et al.
Journal of cellular and molecular medicine, 22(11), 5333-5345 (2018-08-07)
General control nondepressible 5 (GCN5), the first identified transcription-related lysine acetyltransferase (KAT), is an important catalytic component of a transcriptional regulatory SAGA (Spt-Ada-GCN5-Acetyltransferase) and ATAC (ADA2A-containing) complex. While GCN5 has been implicated in cancer development, its role in cervical cancer
Kun Liu et al.
International journal of molecular sciences, 16(9), 21897-21910 (2015-09-18)
The general control of nucleotide synthesis 5 (GCN5), which is one kind of lysine acetyltransferases, regulates a number of cellular processes, such as cell proliferation, differentiation, cell cycle and DNA damage repair. However, its biological role in human glioma development
Changhan Ouyang et al.
Autophagy, 16(10), 1753-1770 (2019-12-28)
Macroautophagy/autophagy, a fundamental process for degradation of macromolecules and organelles, occurs constitutively at a basal level and is upregulated in response to stress. Whether autophagy regulates protein acetylation and microtubule stability in vascular smooth muscle cells (VSMCs) migration, however, remains

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service