Skip to Content
Merck
All Photos(1)

Key Documents

EHU119431

Sigma-Aldrich

MISSION® esiRNA

targeting human PDPN

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTGCTCTTCGTTTTGGGAAGCGCGTCGCTCTGGGTCCTGGCAGAAGGAGCCAGCACAGGCCAGCCAGAAGATGACACTGAGACTACAGGTTTGGAAGGCGGCGTTGCCATGCCAGGTGCCGAAGATGATGTGGTGACTCCAGGAACCAGCGAAGACCGCTATAAGTCTGGCTTGACAACTCTGGTGGCAACAAGTGTCAACAGTGTAACAGGCATTCGCATCGAGGATCTGCCAACTTCAGAAAGCACAGTCCACGCGCAAGAACAAAGTCCAAGCGCCACAGCCTCAAACGTGGCCACCAGTCACTCCACGGAGAAAGTGGATGGAGACACACAGACAACAGTTGAGAAAGATGGTTTGTCAACAGTGACCCTGGTTGGAATCATAGTTGGGGTCTTACTAGCCATCGGCTTCATTGGTGCAATCATCGT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Ekele Ikpegbu et al.
Journal of cellular physiology, 233(7), 5334-5347 (2017-12-08)
E11/podoplanin is critical in the early stages of osteoblast-to-osteocyte transitions (osteocytogenesis), however, the upstream events which regulate E11 expression are unknown. The aim of this study was to examine the effects of FGF-2 on E11-mediated osteocytogenesis and to reveal the
Jiang-Chao Li et al.
Molecular medicine reports, 10(3), 1513-1518 (2014-06-19)
Podoplanin (PDPN) is a well established lymphatic endothelial marker and has frequently been observed in cancer cells at the edge of cancer masses. Previous studies investigating the association between PDPN expression and patient prognosis have had contradictory results. In the
Lewis S C Ward et al.
Journal of cell science, 132(5) (2019-02-13)
Mesenchymal stromal cells (MSCs) upregulate podoplanin at sites of infection, chronic inflammation and cancer. Here, we investigated the functional consequences of podoplanin expression on the migratory potential of MSCs and their interactions with circulating platelets. Expression of podoplanin significantly enhanced
Lusine Danielyan et al.
EBioMedicine, 60, 102989-102989 (2020-09-14)
Stem cells` (SC) functional heterogeneity and its poorly understood aetiology impedes clinical development of cell-based therapies in regenerative medicine and oncology. Recent studies suggest a strong correlation between the SC migration potential and their therapeutic efficacy in humans. Designating SC
Hyun-Yi Kim et al.
Oncology reports, 34(2), 833-842 (2015-06-18)
We investigated the clinical significance of podoplanin expression in relation to clinicopathological variables in head and neck squamous cell carcinoma (HNSCC), to determine its effectiveness as a marker for high-risk HNSCC patients. Upregulation of podoplanin in HNSCC tissues was examined

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service