Skip to Content
Merck
All Photos(1)

Key Documents

EHU084551

Sigma-Aldrich

MISSION® esiRNA

targeting human STMN1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TACACTGCCTGTCGCTTGTCTTCTATTCACCATGGCTTCTTCTGATATCCAGGTGAAAGAACTGGAGAAGCGTGCCTCAGGCCAGGCTTTTGAGCTGATTCTCAGCCCTCGGTCAAAAGAATCTGTTCCAGAATTCCCCCTTTCCCCTCCAAAGAAGAAGGATCTTTCCCTGGAGGAAATTCAGAAGAAATTAGAAGCTGCAGAAGAAAGACGCAAGTCCCATGAAGCTGAGGTCTTGAAGCAGCTGGCTGAGAAACGAGAGCACGAGAAAGAAGTGCTTCAGAAGGCAATAGAAGAGAACAACAACTTCAGTAAAATGGCAGAAGAGAAACTGACCCACAAAATGGAAGCTAATAAAGAGAACCGAGAGGCACAAATGGCTGCCAAACTGGAACGTTTGCGAGAGAAGGATAAGCACATTGAAGAAGTGCGGAA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Pinjie Bao et al.
Annals of surgical oncology, 24(13), 4017-4024 (2017-09-22)
Known as a microtubule-destabilizing protein, STMN1 (gene symbol: STMN1) regulates the dynamics of microtubules, cell cycle progress, and chemo-resistance against taxane agents. It is highly expressed in various human cancers and involved in cancer progression as well as poor prognosis.
Deepmala Shrestha et al.
Journal of cellular biochemistry, 119(2), 2381-2395 (2017-09-09)
Stathmin/oncoprotein18 regulates microtubule dynamics and participates in mitotic entry and exit. We isolated stathmin as a physically interacting partner of KIFC1, a minus-end-directed kinesin functioning in bipolar spindle formation and maintenance. We found that stathmin depletion leads to multipolar spindle
C M Fife et al.
Oncogene, 36(4), 501-511 (2016-06-21)
Neuroblastoma, the most common solid tumor of young children, frequently presents with aggressive metastatic disease and for these children the 5-year survival rates are dismal. Metastasis, the movement of cancer cells from one site to another, involves remodeling of the
Valerie B Sampson et al.
Oncotarget, 7(52), 86594-86607 (2016-11-20)
Osteosarcoma is the most frequently occurring bone cancer in children and adolescents. Unfortunately, treatment failures are common. Eribulin is a synthetic microtubule inhibitor that has demonstrated activity in preclinical osteosarcoma models. The effects of eribulin were evaluated in two human
Long-Xian Lv et al.
Oncotarget, 8(16), 26992-27006 (2017-05-04)
Hispidin and its derivatives are widely distributed in edible mushrooms. Hispidin is more cytotoxic to A549, SCL-1, Bel7402 and Capan-1 cancer cells than to MRC5 normal cells; by contrast, hispidin protects H9c2 cardiomyoblast cells from hydrogen peroxide-induced or doxorubicin-induced apoptosis.

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service