Skip to Content
Merck
All Photos(1)

Documents

EHU053231

Sigma-Aldrich

MISSION® esiRNA

targeting human CD38

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TTGGGAACTCAGACCGTACCTTGCAACAAGATTCTTCTTTGGAGCAGAATAAAAGATCTGGCCCATCAGTTCACACAGGTCCAGCGGGACATGTTCACCCTGGAGGACACGCTGCTAGGCTACCTTGCTGATGACCTCACATGGTGTGGTGAATTCAACACTTCCAAAATAAACTATCAATCTTGCCCAGACTGGAGAAAGGACTGCAGCAACAACCCTGTTTCAGTATTCTGGAAAACGGTTTCCCGCAGGTTTGCAGAAGCTGCCTGTGATGTGGTCCATGTGATGCTCAATGGATCCCGCAGTAAAATCTTTGACAAAAACAGCACTTTTGGGAGTGTGGAAGTCCATAATTTGCAACCAGAGAAGGTTCAGACACTAGAGGCCTGGGTGATACATG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Yoshio Ogura et al.
Aging, 12(12), 11325-11336 (2020-06-09)
Mitochondrial oxidative stress is a significant contributor to the pathogenesis of diabetic kidney disease (DKD). We previously showed that mitochondrial oxidative stress in the kidneys of Zucker diabetic fatty rats is associated with a decreased intracellular NAD+/NADH ratio and NAD+-dependent
Cheng-Bo Song et al.
Journal of translational medicine, 18(1), 95-95 (2020-02-26)
Despite the effective antiretroviral treatment (ART) of HIV-infected individuals, HIV persists in a small pool. Central memory CD4+ T cells (Tcm) make a major contribution to HIV persistence. We found that unlike HLA-DR, CD38 is highly expressed on the Tcm
Longfei Gao et al.
Frontiers in cellular neuroscience, 13, 316-316 (2019-07-23)
Mitochondria are the critical organelles for energy metabolism and cell survival in eukaryotic cells. Recent studies demonstrated that mitochondria can intercellularly transfer between mammalian cells. In neural cells, astrocytes transfer mitochondria into neurons in a CD38-dependent manner. Here, using co-culture

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service