Skip to Content
Merck
All Photos(1)

Key Documents

EHU037121

Sigma-Aldrich

MISSION® esiRNA

targeting human CA9

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CACTCCTGCCCTCTGACTTCAGCCGCTACTTCCAATATGAGGGGTCTCTGACTACACCGCCCTGTGCCCAGGGTGTCATCTGGACTGTGTTTAACCAGACAGTGATGCTGAGTGCTAAGCAGCTCCACACCCTCTCTGACACCCTGTGGGGACCTGGTGACTCTCGGCTACAGCTGAACTTCCGAGCGACGCAGCCTTTGAATGGGCGAGTGATTGAGGCCTCCTTCCCTGCTGGAGTGGACAGCAGTCCTCGGGCTGCTGAGCCAGTCCAGCTGAATTCCTGCCTGGCTGCTGGTGACATCCTAGCCCTGGTTTTTGGCCTCCTTTTTGCTGTCACCAGCGTCGCGTTCCTTGTGCAGATGAGAAGGCAGCACAGAAGGGGAACCAAAGGGGGTGTGAGCTACCGCCCAGCAGAGGTAGCCGAGACTGGAGCCTAGAGGCTGGATCTTGGAGAATGTGAGAAGCCAGC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... CA9(768) , CA9(768)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Kuo-Tai Hua et al.
Scientific reports, 7(1), 4466-4466 (2017-07-02)
Carbonic anhydrase IX (CA9) expression level has been considered as a poor prognostic factor in hepatocellular carcinoma (HCC) patients. However, the judging criteria of CA9 level is hard to define for potential clinical applications. Unlike CA9 expression level, CA9 polymorphism
Min-Chieh Hsin et al.
Cancers, 13(5) (2021-04-04)
Carbonic anhydrase IX (CAIX) is a hypoxia-induced protein that is highly expressed in numerous human cancers. However, the molecular mechanisms involved in CAIX and human cervical cancer metastasis remain poorly understood. In this study, CAIX overexpression in SiHa cells increased
Martin Benej et al.
Frontiers in oncology, 10, 1462-1462 (2020-09-29)
Tumor hypoxia represents a severe microenvironmental stress that is frequently associated with acidosis. Cancer cells respond to these stresses with changes in gene expression that promote survival at least in part through pH regulation and metabolic reprogramming. Hypoxia-induced carbonic anhydrase
Somayeh Jamali et al.
Scientific reports, 5, 13605-13605 (2015-09-05)
The most aggressive tumour cells, which often reside in hypoxic environments, rely on glycolysis for energy production. Thereby they release vast amounts of lactate and protons via monocarboxylate transporters (MCTs), which exacerbates extracellular acidification and supports the formation of a

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service