Skip to Content
Merck
All Photos(1)

Documents

EHU029441

Sigma-Aldrich

MISSION® esiRNA

targeting human MEX3C

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CATATTGCCATGCGTACAGGAAACTATATAGAGCTCAATGAAGAGAATGATTTCCATTACAATGGTACCGATGTAAGCTTTGAAGGTGGCACTCTTGGCTCTGCGTGGCTCTCCTCCAATCCTGTTCCTCCTAGCCGCGCAAGAATGATATCCAATTATCGAAATGATAGTTCCAGTTCTCTAGGAAGTGGCTCTACAGATTCCTACTTTGGAAGCAATAGGCTGGCTGACTTTAGTCCAACAAGCCCATTTAGCACAGGAAACTTCTGGTTTGGAGATACACTACCATCTGTAGGCTCAGAAGACCTAGCAGTTGACTCTCCTGCCTTTGACTCTTTACCAACATCTGCTCAAACTATCTGGACTCCATTTGAACCAGTTAACCCACTCTCTGGCTTTGGGAGTGATCCTTCTGG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Qingsong Hu et al.
Cell research, 29(4), 286-304 (2019-01-12)
Despite the structural conservation of PTEN with dual-specificity phosphatases, there have been no reports regarding the regulatory mechanisms that underlie this potential dual-phosphatase activity. Here, we report that K27-linked polyubiquitination of PTEN at lysines 66 and 80 switches its phosphoinositide/protein
Pin Lu et al.
PloS one, 12(10), e0185992-e0185992 (2017-10-06)
Some RNA species, especially microRNAs, are non-randomly sorted into exosomes, but how selectivity of RNA exosomal sorting is achieved is unknown. We found that all three variants of RNA-binding ubiquitin E3 ligase (MEX3C)-MEX3C-1, MEX3C-2, and MEX3C-3 -interact with adaptor-related protein
Yajuan Li et al.
The Journal of clinical investigation, 129(3), 1129-1151 (2019-02-12)
Epithelial-mesenchymal transition (EMT) contributes significantly to interstitial matrix deposition in diabetic kidney disease (DKD). However, detection of EMT in kidney tissue is impracticable, and anti-EMT therapies have long been hindered. We reported that phosphatase and tensin homolog (PTEN) promoted transforming

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service