Skip to Content
Merck
All Photos(1)

Key Documents

EHU111181

Sigma-Aldrich

MISSION® esiRNA

targeting human KPNA2

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ACCAAGGCTGTGGTAGATGGAGGTGCCATCCCAGCATTCATTTCTCTGTTGGCATCTCCCCATGCTCACATCAGTGAACAAGCTGTCTGGGCTCTAGGAAACATTGCAGGTGATGGCTCAGTGTTCCGAGACTTGGTTATTAAGTACGGTGCAGTTGACCCACTGTTGGCTCTCCTTGCAGTTCCTGATATGTCATCTTTAGCATGTGGCTACTTACGTAATCTTACCTGGACACTTTCTAATCTTTGCCGCAACAAGAATCCTGCACCCCCGATAGATGCTGTTGAGCAGATTCTTCCTACCTTAGTTCGGCTCCTGCATCATGATGATCCAGAAGTATTAGCAGATACCTGCTGGGCTATTTCCTACCTTACTGATGGTCCAAATGAACGAATTGGCATG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Kamalakannan Radhakrishnan et al.
International journal of molecular sciences, 21(7) (2020-04-16)
Mediator of DNA damage checkpoint protein 1 (MDC1) plays a vital role in DNA damage response (DDR) by coordinating the repair of double strand breaks (DSBs). Here, we identified a novel interaction between MDC1 and karyopherin α-2 (KPNA2), a nucleocytoplasmic
Jia He et al.
Autophagy, 16(12), 2238-2251 (2020-09-15)
KPNA2/importin-alpha1 (karyopherin subunit alpha 2) is the primary nucleocytoplasmic transporter for some transcription factors to activate cellular proliferation and differentiation. Aberrant increase of KPNA2 level is identified as a prognostic marker in a variety of cancers. Yet, the turnover mechanism
Jie-Xin Huang et al.
OncoTargets and therapy, 12, 11475-11486 (2020-01-11)
Karyopherin alpha 2 (KPNA2) has been reported as an oncogenic protein in numerous human cancers and is currently considered a potential therapeutic target. However, the transcriptional regulation and physiological conditions underlying KPNA2 expression remain unclear. The aim of the present

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service