Skip to Content
Merck
All Photos(1)

Key Documents

EHU021751

Sigma-Aldrich

MISSION® esiRNA

targeting human ALKBH5

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TTCAAGCCTATTCGGGTGTCGGAACCAGTGCTTTCCCTGCCGGTGCGCAGGGGAAGCGTGACTGTGCTCAGTGGATATGCTGCTGATGAAATCACTCACTGCATACGGCCTCAGGACATCAAGGAGCGCCGAGCAGTCATCATCCTCAGGAAGACAAGATTAGATGCACCCCGGTTGGAAACAAAGTCCCTGAGCAGCTCCGTGTTACCACCCAGCTATGCTTCAGATCGCCTGTCAGGAAACAACAGGGACCCTGCTCTGAAACCCAAGCGGTCCCACCGCAAGGCAGACCCTGATGCTGCCCACAGGCCACGGATCCTGGAGATGGACAAGGAAGAGAACCGGCGCTCGGTGCTGCTGCCCACACACCGGCGGAGGGGTAGCTTCAGCTCTGAGAACTACTGGCGCAAGTCATACGAGTCCTCAGAGGACTGCTCTGAGGCAGCAGGCAGCCCTGCCCGAAAGTCTACCCGCCGCCCTCCTGGGAACTCTGGCTC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Zhiyuan Zhu et al.
Gene, 731, 144348-144348 (2020-01-14)
Mounting evidence demonstrates that N6-methyladenosine (m6A) play critical roles of m6A in the epigenetic regulation, especially for human cancer. The m6A modification is installed by methyltransferase and erased demethylases, leading to the significant modification for gene expression and cell fate.
Shuo Chen et al.
Cancer cell international, 20, 34-34 (2020-02-06)
Osteosarcoma (OS) is one of the most common malignant bone tumors. Plasmacytoma variant translocation 1 (PVT1) is a well-known oncogenic long noncoding RNA (lncRNA). However, to date, the regulatory mechanism of PVT1 upregulation in OS remains unknown. qRT-PCR was carried
Lianpin Wu et al.
BMC cancer, 19(1), 326-326 (2019-04-07)
Breast cancer (BC) displays striking genetic, epigenetic and phenotypic diversity. N6-methyladenosine (m6A) in mRNA has emerged as a crucial epitranscriptomic modification that controls cancer self-renewal and cell fate. However, the key enzymes of m6A expression and function in human breast
Chenyue Ding et al.
Journal of cellular physiology, 233(9), 7055-7066 (2018-02-01)
The N6-methyladenosine (m6A) modification plays a central role in epigenetic regulation of the mammalian transcriptome. m6A can be demethylated by the fat mass- and obesity-associated (FTO) protein and the α-ketoglutarate-dependent dioxygenase alkB homolog 5 (ALKBH5) protein. Much less is known
Boyang Liu et al.
Cell death & disease, 11(5), 384-384 (2020-05-23)
Temozolomide (TMZ) resistance is a major cause of recurrence and poor prognosis in glioblastoma (GBM). Recently, increasing evidences suggested that long noncoding RNAs (LncRNAs) modulate GBM biological processes, especially in resistance to chemotherapy, but their role in TMZ chemoresistance has

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service