MSTUD0114

MISSION^® Synthetic microRNA Inhibitor, Mouse

mmu-miR-199a-5p

• UNSPSC 코드: 41105324
• NACRES: NA.51

속성

• Quality Level: 100
• 제품 라인: MISSION^®
• 양식: solid
• 성숙 서열: CCCAGUGUUCAGACUACCUGUUC
• 상거(Sanger) 성숙/소수 수납 번호: MIMAT0000229
• microRNA 수납 번호: MI0000713
• 저장 온도: −20°C

설명

일반 설명

Individual synthetic microRNA inhibitors were designed using a proprietary algorithm, which is based on the work of Haraguchi, T, et al. and in collaboration with Dr. Hideo Iba, University of Tokyo.[1] This algorithm utilizes the tough decoy (TuD) design. miRNA are known to regulate gene expression in a variety of manners, including translational repression, mRNA cleavage and deadenylation.

The MISSION synthetic miRNA Inhibitors are small, double-stranded RNA molecules designed to inhibit a specific mature miRNA. The miRNA inhibitors were designed using the mature miRNA sequence information from miRBase and are 2′-O-methylated RNA duplexes with a miRNA binding site on each strand. Optimal miRNA inhibition is provided after transfection due to the robust secondary structure of the inhibitor.

• Long lasting inhibition at very low dosage
• Excellent resistance to cellular nucleases
• Custom synthesis available for a variety of species

Two negative controls are available: Arabidopsis thaliana sequence (NCSTUD001) and Caenorhabditis elegans sequence (NCSTUD002)

기타 정보

Based on miRBase V19

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

안전성 정보

• 픽토그램: GHS08
• 신호어: Warning
• 유해 및 위험 성명서: H373
• 예방조치 성명서: P260 - P314 - P501
• Hazard Classifications: STOT RE 2 Inhalation
• 표적 기관: Respiratory Tract
• Storage Class Code: 11 - Combustible Solids
• WGK: WGK 3
• Flash Point (°F): Not applicable
• Flash Point (°C): Not applicable