콘텐츠로 건너뛰기
Merck
모든 사진(1)

문서

MLTUD1349

Sigma-Aldrich

MISSION® Lenti microRNA Inhibitor, Mouse

mmu-miR-6386

동의어(들):

Tough Decoy, TuD

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41106609
NACRES:
NA.51

제품 라인

MISSION®

농도

≥1x106 VP/ml (via p24 assay)

성숙 서열

CAUGCCUUAGGGUGGGAUGCAAGU

상거(Sanger) 성숙/소수 수납 번호

상거 microRNA 수납 번호

배송 상태

dry ice

저장 온도

−70°C

일반 설명

Individual lenti microRNA inhibitors are designed using a proprietary algorithm, which is based on the work of Haraguchi, T, et al. and in collaboration with Dr. Hideo Iba, University of Tokyo. This algorithm utilizes the tough decoy (TuD) design. miRNA are known to regulate gene expression in a variety of manners, including translational repression, mRNA cleavage and deadenylation. The lentiviral microRNA Inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection of this vector into the appropriate cell line with compatible packaging plasmids produces viral particles that can be used to transduce mammalian cells. Additionally, the Woodchuck Hepatitis Post-Transcriptional Regulatory Element2 (WPRE) is included, allowing for enhanced expression of transgenes delivered by lentiviral vectors. This lentiviral vector also carries a puromycin resistance gene for selection of cells.

Allows for potent inhibition of the desired miRNA
Lentiviral delivery format allows for efficient delivery of the inhibitor into a wide variety of cell types
Enables long-term inhibition without repeat transfection

기타 정보

Based on miRBase V19 Mature ID

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.