MLMIR0533

MISSION^® Lenti microRNA, Mouse

mmu-miR-1224-3p

• UNSPSC 코드: 41106609
• NACRES: NA.51

속성

• Quality Level: 200
• 제품 라인: MISSION^®
• 형태: liquid
• 농도: ≥1x10⁶ VP/ml (via p24 assay)
• 성숙 서열: CCCCACCUCUUCUCUCCUCAG
• 상거(Sanger) 성숙/소수 수납 번호: MIMAT0017231
• 상거 microRNA 수납 번호: MI0004118
• 배송 상태: dry ice
• 저장 온도: −70°C

설명

일반 설명

Sigma′s Mission Lenti-miRs express miRNAs from a common backbone, whose structure meets requirements for accurate Dicer processing and a partially complementary strand is designed to mimic the base pairing pattern in the backbone structure using a proprietary algorithm. Oligos containing the microRNA sequences are cloned into the TRC2-pLKO-puro vector. Each miRNA construct has been cloned and sequence verified. Mature microRNA sequences are obtained from miRBase.Lentiviral transduction particles are produced from sequence-verified lentiviral plasmid vectors. Oligos containing the microRNA sequences are cloned into the TRC2-pLKO-puro vector. Co-transfection of this vector into the appropriate cell line with compatible packaging plasmids produces viral particles that can be used to transduce mammalian cells. The polymerase II promoter, elongation factor 1 alpha (EF1A), was chosen to drive miRNA expression needed for reverse transcription of viral RNA and integration of viral DNA into the host cell genome. Additionally, the Woodchuck Hepatitis Post-Transcriptional Regulatory element allowing for enhanced expression of transgenes delivered by lentiviral vectors. This lentiviral vector also carries a puromycin resistance gene for selection of cells. Unlike murine-based MMLV or MSCV retroviral systems, lentiviral-based particles permit efficient infection and integration of the specific miRNA construct into differentiated and non-dividing cells, such as neurons and dendritic cells.

기타 정보

Based on miRBase V20 Mature ID

추천 제품

Two negative controls are available: NCLMIR001 and NCLMIR002

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

안전성 정보

• Storage Class Code: 12 - Non Combustible Liquids
• WGK: WGK 3
• Flash Point (°F): Not applicable
• Flash Point (°C): Not applicable