설명
Functional Validation of miRNA Gene Targets
제품 라인
MISSION®
농도
≥1x105 VP/ml (via p24 assay)
인간 3′UTR 서열
CTTGCTCAGCTGCTCACCCGGCGGAGGCGGACGTGGAGGGACAGGGACGCGCGCCCAGACACGGACATGCGCCCGGACACGGACACGCGCCCAGACACGG
NCBI 수납 번호
배송 상태
dry ice
저장 온도
−70°C
유전자 정보
human ... SLC6A18(348932)
애플리케이션
To see more application data, protocols, and vector maps visit www.sigma.com/3utr.
물리적 형태
200 μL of at least 105 VP/mL (via p24 titering assay) lentiviral particles are provided as frozen stock.
법적 정보
Use of this product is subject to one or more license agreements. For details, please see www.sigmaaldrich.com/missionlicense.
GoClone is a trademark of SwitchGear Genomics
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
SwitchGear Genomics is a trademark of SwitchGear Genomics
Storage Class Code
12 - Non Combustible Liquids
WGK
WGK 3
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
시험 성적서(COA)
제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.