콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

HMI1940

Sigma-Aldrich

MISSION® microRNA Mimic

hsa-miR-1271-3p

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
12352200

제품 라인

MISSION®

양식

solid

성숙 서열

AGUGCCUGCUAUGUGCCAGGCA

상거(Sanger) 성숙/소수 수납 번호

상거 microRNA 수납 번호

저장 온도

−20°C

유전자 정보

일반 설명

The ready-to-use MISSION miRNA mimics are small, double-stranded RNA molecules designed to mimic endogenous mature miRNA molecules when introduced into cells. miRNA are known to regulate gene expression in a variety of manners, including translational repression, mRNA cleavage and deadenylation. MISSION miRNA Mimics, a member of MISSION RNAi product family, provides miRNA researchers with a range of options from individual MISSION mimics to a full library of human miRNA mimics based on latest version of miRBase (currently hosted by the University of Manchester, previously hosted by the Sanger Institute).

  • Optimized and ready for transfection.
  • Novel MISSION miRNA mimic design has been functionally tested for knockdown efficiency against natural miRNA targets.
  • Unique MISSION miRNA mimic design significantly reduces possible sense strand off target effects.
  • Available as a whole human library and individual miRNA targets.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

13 - Non Combustible Solids

WGK

WGK 3

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our 문서 section.

도움이 필요하시면 연락하세요. 고객 지원 부서

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.