콘텐츠로 건너뛰기
Merck
모든 사진(1)

문서

EMU208521

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Emr1

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

GAGTGTGATGACACATGTCCTTTGAATTCATCATGTACCAACACTATTGGGAGCTACTTCTGCACTTGCCACCCTGGCTTTGCATCTAGCAATGGACAGCTGAATTTCAAAGACCTAGAGGTGACATGTGAAGATATTGATGAGTGCACCCAAGATCCATTACAATGTGGACTGAATTCTGTCTGCACCAATGTACCAGGCTCCTACATCTGTGGCTGCCTCCCTGACTTTCAAATGGATCCAGAAGGCTCCCAAGGATATGGAAACTTCAACTGCAAAAGGATCCTCTTCAAGTGTAAGGAAGACTTGATACTCCAAAGTGAGCAGATACAGCAATGCCAAGCAGTGCAGGGCAGGGATCTTGGTTATGCTTCCTTCTGTACACTTGTGAATGCTACCTTCACAATCCTTGATAATACCTGTGAGAACAAAAGTGCCCCAGTGTCCTTACAGAGTGCAGCTACAAGTGTCTCCCTCGTGCTGGAGCAAGCGACCACATGGTTTGAGCTCAGCA

Ensembl | 마우스 수납 번호

ENSMUSG00000004730

NCBI 수납 번호

NM_010130

배송 상태

ambient

저장 온도

−20°C

유전자 정보

mouse ... EMR1(13733) , Emr1(13733)

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Michael J Hansen et al.
Inflammation research : official journal of the European Histamine Research Society ... [et al.], 64(9), 697-706 (2015-07-08)
Adipose tissue macrophages (ATMs) have been implicated in a number of obesity-related diseases. Because the activated macrophages associated with many types of autoimmune and inflammatory diseases express a folate receptor (FR) that can be exploited for FR-targeted drug delivery, we
Takako Serizawa et al.
Infection and immunity, 84(2), 562-572 (2015-12-09)
Histopathological changes of the gastric mucosa after Helicobacter pylori infection, such as atrophy, metaplasia, and dysplasia, are considered to be precursors of gastric cancer, yet the mechanisms of histological progression are unknown. The aim of this study was to analyze
Fabiana N Soki et al.
Oncotarget, 6(34), 35782-35796 (2015-10-16)
Resident macrophages in bone play important roles in bone remodeling, repair, and hematopoietic stem cell maintenance, yet their role in skeletal metastasis remains under investigated. The purpose of this study was to determine the role of macrophages in prostate cancer
Chiyoko Sekine et al.
Arthritis & rheumatology (Hoboken, N.J.), 66(10), 2751-2761 (2014-06-20)
We previously reported that blockade of the Notch ligand delta-like protein 1 (DLL-1) suppressed osteoclastogenesis and ameliorated arthritis in a mouse model of rheumatoid arthritis (RA). However, the mechanisms by which joint inflammation were suppressed have not yet been revealed.

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.