설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
TACCATGAATGGAACCAGCAACAGCCCCAGTGCTAACCACCAATCTTCCTTTGCCAGTAGACCTCGAAAATCATCACTAAATGGGTCATCAGCAACTTCATCTGGTTAGGACTGTTAAGGAAAAGATTTTTCAACCCCCTGATTTAGTTACCTTCATTCATTACAGCTTTATAGATGCTTAATACATGTGACTGTCGTCCAGTTTGCTTCCTTTTGTAGTGACTTTAAATTTGGCCATAAATGATGGACTAGATGTGATACTTCATATGGATGTTAAGTGGAAAGATTGATTCTTTCTCTAAAGAATTGGATTCTGAGAAGGATTCTGTGTTAGGAAAGATGTGAAATGATTTCTGTGACCACTGTTTGGATCTGGAAATGTTCTACAGTGGGTAGACATTGGGC
Ensembl | 마우스 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
mouse ... BMI1(12151) , Bmi1(12151)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Dan Xiong et al.
Cancer biology & therapy, 16(5), 756-763 (2015-04-17)
Previous studies indicate that the role of B lymphoma Mo-MLV insertion region 1 homolog (Bmi-1) is responsible for multiple cancer progression. However, Bmi-1 in controlling gene expression in non-small cell lung cancer (NSCLC) development is not well explored. Here we
Boyang Chang et al.
Biochimica et biophysica acta, 1840(12), 3285-3291 (2014-08-26)
Bmi-1 had been found to involve in self renewal of stem cells and tumorigenesis in various malignancies. In this study, we investigated the role of Bmi-1 in the development of salivary adenoid cystic carcinoma (SACC). At first, we confirmed that
Lei Liu et al.
International journal of clinical and experimental pathology, 8(6), 6674-6682 (2015-08-12)
The aim of this study was to evaluate the efficiency of a targeted siRNA nano-delivery system to silence the expression of Bmi-1 and hTERT, and to verify the toxicity of this delivery system in MCF-7 breast cancer cells. The most
F Wei et al.
Oncogene, 34(23), 3063-3075 (2014-08-05)
The BMI1 protein contributes to stem cell pluripotency and oncogenesis via multiple functions, including its newly identified role in DNA damage response (DDR). Although evidence clearly demonstrates that BMI1 facilitates the repair of double-stranded breaks via homologous recombination (HR), it
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.