콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EMU093981

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Bmi1

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

TACCATGAATGGAACCAGCAACAGCCCCAGTGCTAACCACCAATCTTCCTTTGCCAGTAGACCTCGAAAATCATCACTAAATGGGTCATCAGCAACTTCATCTGGTTAGGACTGTTAAGGAAAAGATTTTTCAACCCCCTGATTTAGTTACCTTCATTCATTACAGCTTTATAGATGCTTAATACATGTGACTGTCGTCCAGTTTGCTTCCTTTTGTAGTGACTTTAAATTTGGCCATAAATGATGGACTAGATGTGATACTTCATATGGATGTTAAGTGGAAAGATTGATTCTTTCTCTAAAGAATTGGATTCTGAGAAGGATTCTGTGTTAGGAAAGATGTGAAATGATTTCTGTGACCACTGTTTGGATCTGGAAATGTTCTACAGTGGGTAGACATTGGGC

Ensembl | 마우스 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Dan Xiong et al.
Cancer biology & therapy, 16(5), 756-763 (2015-04-17)
Previous studies indicate that the role of B lymphoma Mo-MLV insertion region 1 homolog (Bmi-1) is responsible for multiple cancer progression. However, Bmi-1 in controlling gene expression in non-small cell lung cancer (NSCLC) development is not well explored. Here we
Boyang Chang et al.
Biochimica et biophysica acta, 1840(12), 3285-3291 (2014-08-26)
Bmi-1 had been found to involve in self renewal of stem cells and tumorigenesis in various malignancies. In this study, we investigated the role of Bmi-1 in the development of salivary adenoid cystic carcinoma (SACC). At first, we confirmed that
Lei Liu et al.
International journal of clinical and experimental pathology, 8(6), 6674-6682 (2015-08-12)
The aim of this study was to evaluate the efficiency of a targeted siRNA nano-delivery system to silence the expression of Bmi-1 and hTERT, and to verify the toxicity of this delivery system in MCF-7 breast cancer cells. The most
F Wei et al.
Oncogene, 34(23), 3063-3075 (2014-08-05)
The BMI1 protein contributes to stem cell pluripotency and oncogenesis via multiple functions, including its newly identified role in DNA damage response (DDR). Although evidence clearly demonstrates that BMI1 facilitates the repair of double-stranded breaks via homologous recombination (HR), it

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.