콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EMU089831

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Sp7

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

GCTTTACCAGAAGCGACCACTTGAGCAAACATCAGCGCACCCACGGGGAGCCAGGCCCGGGACCGCCCCCAAGTGGCCCTAAGGAGCTGGGGGAGGGTCGCAGCGTCGGGGAAGAAGAAGCCAATCAGCCGCCCCGATCTTCCACTTCGCCTGCACCCCCAGAAAAAGCCCACGGAGGCAGCCCAGAGCAGAGCAACCTGCTAGAGATCTGAGCCGGGTAGAGGAAGGTCTCCAGCTCCAGGGTCCTCTTGCCAGGCTCTCTTGGCGTGCTGGACCCATTGGTTGCCCCTCGCTCTCTCCTATTGCATGCTATACTCTGGGGGCTCTCTCTGTTCCCCTAGGCTATCTCCTTGCATGTCTCCTCAGTTCTTCTCTCTTTGTCAAGAGTCTTAGCCAAACTCCTCTCAGGCCTTTGCCAGTGCCTAGTTCCTATGCTCCGACCTCCTCAACTTTTTCTTCTCTGCCCCTGTTCTTCACAGCTTCCATCTGGCCTCACATCATTTTCTCATTAACTCGTTGCCATCTAATCTTTCTGCTTCCCAATCCTATTTGC

Ensembl | 마우스 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Ning Li et al.
Molecular therapy. Nucleic acids, 22, 971-980 (2020-12-01)
Calcific aortic valve disease (CAVD) is a common heart valve disease in aging populations, and aberrant osteogenic differentiation of valvular interstitial cells (VICs) plays a critical role in the pathogenesis of ectopic ossification of the aortic valve. miR-214 has been
Wen-lin Xiao et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 36(3), 1015-1025 (2015-06-27)
The relationship between the p38MAPK signaling pathway and osterix in osteogenic differentiation of BMMSCs subjected to intermittent stretching was investigated. BMMSCs derived from C57BL/6J mice were divided into the following groups: 1) control, 2) stretch, and 3) SB203580+stretch (SB203580 is
Y Zhang et al.
Oral diseases, 21(5), 583-592 (2015-02-05)
To understand the differences and similarities between immunocompetent and immunodeficient mice as ectopic transplantation animal models for bone tissue engineering. Osteogenic cells from mouse leg bones were cultured, seeded on β-TCP granules, and transplanted onto the backs of either immunocompetent

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.