콘텐츠로 건너뛰기
Merck
모든 사진(1)

문서

EMU078951

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Usp9x

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

TGCCGAGCTATTGATCTCCTTAAAGAGATATACACAAACCTTGGTCCAAGGCTGCAGGTCAATCAGGTGGTGATCCATGAAGACTTCATTCAGTCTTGCTTTGATCGTTTGAAAGCCTCTTATGACACATTGTGTGTTTTGGATGGTGACAAAGACAGTATTAATTGTGCAAGACAGGAAGCTGTTCGAATGGTCCGAGTGTTAACTGTTCTAAGAGAATATATAAATGAATGTGACAGTGATTATCATGAAGAAAGAACAATTTTGCCTATGTCAAGAGCTTTCCGTGGTAAACACCTCTCTTTTATAGTTCGATTTCCAAACCAGGGCAGGCAAGTAGATGACTTGGAGGTTTGGTCTCATACAAATGATACCATTGGTTCAGTTCGAAGATGTATACTCAATCGTATTAAAGCCAATGTAGCTCATACAAAAATTGAACTCTTTGTGGGTGGTGAGC

Ensembl | 마우스 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Jesse L Cox et al.
Cancer biology & therapy, 15(8), 1042-1052 (2014-05-21)
Pancreatic ductal adenocarcinoma (PDAC) is one of the most aggressive and deadly malignancies. Recently, the deubiquitinating protease USP9X has been shown to behave as an oncogene in a number of neoplasms, including those of breast, brain, colon, esophagus and lung
B Wang et al.
Cell death and differentiation, 21(7), 1160-1169 (2014-04-29)
Mcl-1 is a unique antiapoptotic Bcl2 family member with a short half-life due to its rapid turnover through ubiquitination. We discovered that Ku70, a DNA double-strand break repair protein, functions as a deubiquitinase to stabilize Mcl-1. Ku70 knockout in mouse
Deepa Kushwaha et al.
Cancer biology & therapy, 16(3), 392-401 (2015-02-19)
Radiotherapy (RT) is vital for the treatment of locally advanced non-small cell lung cancer (NSCLC), yet its delivery is limited by tolerances of adjacent organs. We sought therefore to identify and characterize gene targets whose inhibition may improve RT. Whole

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.