콘텐츠로 건너뛰기
Merck
모든 사진(1)

Key Documents

EMU074311

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Fermt2

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

TCCGGTTGTCCTTCATCTGTACCGAAGTAGACTGCAAGGTGGTCCACGAATTCATTGGTGGTTACATATTTCTCTCAACTCGTGCGAAAGACCAAAATGAAAGTTTAGATGAGGAGATGTTCTACAAACTCACCAGTGGTTGGGTGTGAATAGGAAAACTTGTAATAAAACTCCACAGCCATAACAATATTTAACTTTAAAGCTATTGTTTCTTATATGCTGCTTAATAAAGTAAGCTTGAACTTTATTATTTTATCATGATACCTTTTTGCCTTACCAGACCAGTACATATGTGCACTAACAAGCACGATTGTTAATCTGCTGCCTACCTTGATATGCCGTATGTGGACTGTGGAATTCCCAACAGTCCTTAGGGCCACGGAAAGCTGTCACTGACTGACAGTAACCAAACTAAGAAACAAGCCATCTACCAAGCCAC

Ensembl | 마우스 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Hai-Feng Zhang et al.
Oncotarget, 6(30), 28949-28960 (2015-09-04)
Our previous studies have shown that loss of miR-200b enhances the invasiveness of esophageal squamous cell carcinoma (ESCC) cells. However, whether the miR-200-ZEB1/2-E-cadherin regulatory cascade, a master regulator of epithelial-to-mesenchymal transition (EMT), is involved in the regulation of ESCC invasion
Yu Yu et al.
PloS one, 8(5), e63490-e63490 (2013-05-30)
Kindlin 2, as an integrin-associated protein, is required for myocyte elongation and fusion. However, the association of Kindlin 2 with muscle differentiation-related signaling pathways is unknown. Here, we identified a mechanism that Kindlin 2 regulates myogenic regulatory factors myogenin via
Zhaoli Liu et al.
FEBS letters, 589(15), 2001-2010 (2015-06-04)
Kindlin-2 regulates external to internal cell signaling by interaction with integrins in a process that involves the tyrosine kinase, Src. However, the underlying mechanisms remain elusive. Here we report that Src binds to and phosphorylates Kindlin-2 at Y193. Reciprocally, Kindlin-2-Y193

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.