설명
Powered by Eupheria Biotech
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
ACAAACCCGATATGGCTGAGATCGAGAAATTCGATAAGTCGAAGTTGAAGAAAACAGAAACGCAAGAGAAAAATCCTCTGCCTTCAAAAGAAACAATTGAACAAGAGAAGCAAGCTGGCGAATCGTAATGAGGCGAGCGCCGCCAATATGCACTGTACATTCCACGAGCATTGCCTTCTTATTTTACTTCTTTTAGCTGTTTAACTTTGTAAGATGCAAAGAGGTTGGATCAAGTTTAAATGACTGTGCTGCCCCTTTCACATCAAAGAATCAGAACTACTGAGCAGGAAGGCCTCCCCTGCCTCTCCCACCCATCTGATGGTCTGGCTAGCAGAGAGGGAAAAGAACTTGCATGTTGGTGAAGGAAAAAGCTGGGTGGGAGATGATGAAATAGAGAGGAAAATTCAACATGGTCAAAGATGTCCTGCAG
Ensembl | 마우스 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
mouse ... TMSB4X(19241) , Tmsb4x(100047211)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Tamotsu Kiyoshima et al.
Stem cell research, 12(1), 309-322 (2013-12-18)
Previous studies have shown that the recombination of cells liberated from developing tooth germs develop into teeth. However, it is difficult to use human developing tooth germ as a source of cells because of ethical issues. Previous studies have reported
Bin Dong et al.
Atherosclerosis, 235(2), 449-462 (2014-06-21)
CETP inhibitors block the transfer of cholesteryl ester from HDL-C to VLDL-C and LDL-C, thereby raising HDL-C and lowering LDL-C. In this study, we explored the effect of CETP inhibitors on hepatic LDL receptor (LDLR) and PCSK9 expression and further
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.