콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EMU063881

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Pecam1

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

TGCAGGAGTCCTTCTCCACTCCCAAGTTTGAAATCAAGCCCCCTGGGATGATCATAGAAGGGGACCAGCTGCACATTAGGTGCATAGTTCAAGTGACACACTTGGTCCAGGAGTTTACAGAAATTATCATCCAAAAAGACAAGGCGATTGTAGCCACCTCCAAGCAAAGCAGTGAAGCTGTCTACTCAGTCATGGCCATGGTCGAGTACAGTGGACACTACACCTGCAAAGTGGAATCAAACCGTATCTCCAAAGCCAGTAGCATCATGGTCAACATAACAGAGCTGTTTCCCAAGCCGAAGTTAGAGTTCTCCTCCAGTCGTCTGGACCAAGGGGAGTTGTTGGACCTGTCCTGCTCCGTCTCGGGCACACCTGTAGCCAACTTCACCATCCAGAAGGAAGAGACGG

Ensembl | 마우스 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Masayasu Hara et al.
Anticancer research, 36(1), 169-177 (2016-01-02)
We evaluated the ability of itraconazole to enhance the effects of bevacizumab in bevacizumab-resistant cancer cells, endothelial cells, and cancer-associated fibroblasts (CAFs). Human gastrointestinal cancer cell lines (HT-29, MKN-28 and MKN-45), human umbilical vein endothelial cells (HUVECs), and CAFs established
Larissa Pfisterer et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 28(8), 3518-3527 (2014-04-29)
Despite the high prevalence of venous diseases that are associated with and based on the structural reorganization of the venous vessel wall, not much is known about their mechanistic causes. In this context, we demonstrated that the quantity of myocardin
Caroline Arnold et al.
EMBO molecular medicine, 6(8), 1075-1089 (2014-06-29)
Arteriogenesis-the growth of collateral arterioles-partially compensates for the progressive occlusion of large conductance arteries as it may occur as a consequence of coronary, cerebral or peripheral artery disease. Despite being clinically highly relevant, mechanisms driving this process remain elusive. In
James Shue-Min Yeh et al.
PloS one, 10(7), e0129681-e0129681 (2015-07-15)
Microbubbles conjugated with targeting ligands are used as contrast agents for ultrasound molecular imaging. However, they often contain immunogenic (strept)avidin, which impedes application in humans. Although targeting bubbles not employing the biotin-(strept)avidin conjugation chemistry have been explored, only a few
Yang Kyung Cho et al.
Cornea, 33(6), 621-627 (2014-04-15)
Dry eye disease is becoming recognized as an immune-inflammation mediated disorder. Surgical insults such as corneal incision or suture can aggravate dry eye. We sought to determine whether underlying dry eye aggravates corneal inflammatory infiltration, hemangiogenesis, and lymphangiogenesis (LY) induced

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.