설명
Powered by Eupheria Biotech
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
CACTGCCACTACTGCAAGGAGGGCTTCTACCGAGACATGGGCAAGCCTATCACCCACCGGAAGGCTTGCAAAGCCTGTGATTGCCACCCAGTGGGTGCTGCTGGCAAGACCTGCAATCAAACCACTGGCCAATGTCCCTGCAAGGACGGCGTGACGGGCATCACCTGCAACCGATGTGCCAAAGGCTACCAGCAGAGCCGTTCCCCCATCGCCCCTTGCATCAAGATTCCTGTGGCGCCGCCCACCACTGCAGCCAGCAGCGTGGAGGAACCGGAAGACTGTGATTCCTATTGCAAGGCCTCCAAAGGCAAGCTGAAGATGAACATGAAGAAATACTGCAGGAAGGACTATGCTGTCCAGATCCACATCCTGAAGGCCGACAAAGCAGGGGACTGGTGGAAGTTCACCGT
Ensembl | 마우스 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
mouse ... NTN1(18208) , Ntn1(18208)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Ping Han et al.
American journal of cancer research, 5(4), 1396-1409 (2015-06-24)
The axon guidance cues netrin-1 has been reported to be associated with cancer progression in various types of human cancers. However, the underlying molecular mechanism of netrin-1-mediated metastasis remains obscure. In this study, we found that overexpression of netrin-1 promoted
Punithavathi Ranganathan et al.
Journal of cellular and molecular medicine, 18(7), 1290-1299 (2014-04-12)
The netrin-1 administration or overexpression is known to protect colon from acute colitis. However, the receptor that mediates netrin-1 protective activities in the colon during colitis remains unknown. We tested the hypothesis that UNC5B receptor is a critical mediator of
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.