콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EMU063601

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Ntn1

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

CACTGCCACTACTGCAAGGAGGGCTTCTACCGAGACATGGGCAAGCCTATCACCCACCGGAAGGCTTGCAAAGCCTGTGATTGCCACCCAGTGGGTGCTGCTGGCAAGACCTGCAATCAAACCACTGGCCAATGTCCCTGCAAGGACGGCGTGACGGGCATCACCTGCAACCGATGTGCCAAAGGCTACCAGCAGAGCCGTTCCCCCATCGCCCCTTGCATCAAGATTCCTGTGGCGCCGCCCACCACTGCAGCCAGCAGCGTGGAGGAACCGGAAGACTGTGATTCCTATTGCAAGGCCTCCAAAGGCAAGCTGAAGATGAACATGAAGAAATACTGCAGGAAGGACTATGCTGTCCAGATCCACATCCTGAAGGCCGACAAAGCAGGGGACTGGTGGAAGTTCACCGT

Ensembl | 마우스 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our 문서 section.

도움이 필요하시면 연락하세요. 고객 지원 부서

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Ping Han et al.
American journal of cancer research, 5(4), 1396-1409 (2015-06-24)
The axon guidance cues netrin-1 has been reported to be associated with cancer progression in various types of human cancers. However, the underlying molecular mechanism of netrin-1-mediated metastasis remains obscure. In this study, we found that overexpression of netrin-1 promoted
Punithavathi Ranganathan et al.
Journal of cellular and molecular medicine, 18(7), 1290-1299 (2014-04-12)
The netrin-1 administration or overexpression is known to protect colon from acute colitis. However, the receptor that mediates netrin-1 protective activities in the colon during colitis remains unknown. We tested the hypothesis that UNC5B receptor is a critical mediator of

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.