콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EMU058651

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Aof2

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

ACTGCCCTCTGCAAGGAATATGATGAATTAGCTGAAACACAAGGAAAGCTAGAAGAAAAACTTCAAGAATTGGAAGCCAATCCCCCAAGTGATGTATACCTCTCATCAAGAGACAGACAAATACTTGACTGGCATTTTGCAAATCTTGAATTTGCCAACGCCACACCTCTCTCTACCCTCTCTCTTAAACATTGGGATCAGGATGATGACTTTGAGTTTACTGGAAGCCACCTGACAGTAAGGAATGGCTACTCATGTGTGCCTGTGGCTTTAGCTGAAGGCTTGGACATTAAACTGAACACAGCAGTGCGGCAGGTTCGCTACACAGCCTCAGGATGTGAAGTGATTGCTGTGAACACACGTTCCACAAGTCAAACCTTTATTTATAAGTGTGATGCAGTTCTCTGTACACTTCCTTTGGGAGTGTTGAAGCAGCAGCCACCAGCTGTTCAGTTTGTGCCACCTCTTCCTGAGTGGAAAACATCTGCAGTCCAAAGGATGGGATTTGGCAACCTTAACAAGGTGGTGTTATGCTTTGACCGTGTGTTCTGGGACCCAAGT

Ensembl | 마우스 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

12 - Non Combustible Liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Melissa M Singh et al.
Neuro-oncology, 17(11), 1463-1473 (2015-03-22)
Glioblastoma (GBM) is the most common and aggressive form of brain cancer. Our previous studies demonstrated that combined inhibition of HDAC and KDM1A increases apoptotic cell death in vitro. However, whether this combination also increases death of the glioma stem
Ghanshyam Upadhyay et al.
Proceedings of the National Academy of Sciences of the United States of America, 111(22), 8071-8076 (2014-05-21)
Lysine-specific demethylase 1 (LSD1) demethylates nucleosomal histone H3 lysine 4 (H3K4) residues in collaboration with the corepressor CoREST/REST corepressor 1 (Rcor1) and regulates cell fates by epigenetically repressing gene targets. The balanced regulation of this demethylase, if any, is however
Sathiya Pandi Narayanan et al.
Cancer letters, 367(2), 162-172 (2015-08-01)
The histone demethylase KDM1A specifically demethylates lysine residues and its deregulation has been implicated in the initiation and progression of various cancers. However, KDM1A's molecular role and its pathological consequences, and prognostic significance in oral cancer remain less understood. In
Stefano Amente et al.
Oncotarget, 6(16), 14572-14583 (2015-06-13)
The chromatin-modifying enzyme lysine-specific demethylase 1, KDM1A/LSD1 is involved in maintaining the undifferentiated, malignant phenotype of neuroblastoma cells and its overexpression correlated with aggressive disease, poor differentiation and infaust outcome. Here, we show that LSD1 physically binds MYCN both in

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.