콘텐츠로 건너뛰기
Merck
모든 사진(1)

Key Documents

EMU055771

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Aurkb

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

100

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

GCCAGAAGTTGGCTGAGAACAAGAGTCAGGGCTCCACTGCCTCGCAAGGATCCCAGAACAAGCAGCCTTTCACTATTGACAACTTTGAGATTGGGCGTCCTTTGGGCAAAGGCAAATTTGGAAACGTGTACTTGGCTCGGGAGAAGAAGAGCCGTTTCATCGTGGCACTCAAGATCCTCTTCAAGTCTCAGATTGAGAAGGAGGGGGTAGAGCACCAGCTTCGCCGAGAGATCGAAATCCAGGCGCACCTGAAACATCCCAACATCCTTCAACTCTACAACTACTTCTACGACCAGCAGAGGATCTACTTAATCCTGGAATACGCCCCTCGCGGGGAACTCTACAAGGAACTGCAGAAGAGTCGGACCTTCGATGAGCAGCGGACTGCCACGATCATGGAGGAACTGTCAGATGCCCTGACCTACTGCCACAAGAAGAAGGTAATTCACAGAGACATAAAGCCGGAGAACCTGCTGTTAGGTCTGCAGGGAG

Ensembl | 마우스 수납 번호

ENSMUSG00000020897

NCBI 수납 번호

NP_035626

배송 상태

ambient

저장 온도

−20°C

유전자 정보

mouse ... AURKB(20877) , Aurkb(20877)

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Antonio Madejón et al.
Journal of hepatology, 63(2), 312-319 (2015-03-04)
Chronic hepatitis C is a leading cause of chronic liver disease, cirrhosis and hepatocellular carcinoma. DNA methylation and histone covalent modifications constitute crucial mechanisms of genomic instability in human disease, including liver fibrosis and hepatocellular carcinoma. The present work studies
Kazuharu Kai et al.
Molecular cancer therapeutics, 14(12), 2687-2699 (2015-10-08)
Currently, no targeted drug is available for triple-negative breast cancer (TNBC), an aggressive breast cancer that does not express estrogen receptor, progesterone receptor, or HER2. TNBC has high mitotic activity, and, because Aurora A and B mitotic kinases drive cell
Lijuan Zhu et al.
The Journal of biological chemistry, 290(45), 27053-27066 (2015-09-18)
Mitotic chromosome segregation is orchestrated by the dynamic interaction of spindle microtubules with the kinetochores. During chromosome alignment, kinetochore-bound microtubules undergo dynamic cycles between growth and shrinkage, leading to an oscillatory movement of chromosomes along the spindle axis. Although kinetochore
Aarthi Jayanthan et al.
PloS one, 9(7), e102741-e102741 (2014-07-23)
Leukemia is the most common pediatric malignancy, constituting more than 30% of all childhood cancers. Although cure rates have improved greatly, approximately one in five children relapse and poor survival rates post relapse remain a challenge. Given this, more effective

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.