설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
CGCCTGAATTCTGCCATTATCTATGACCGAGATTTCTCTTATAACTACTTTGGCTTTAAGACACTGGAACGGTCATATTTGTTGAAGATCAATGGTAAAGTGGCTGAAAGACCACAGCATATGTTGATGAGGGTTTCTGTGGGGATTCACAAAGAAGATATTGATGCTGCAATTGAAACCTACAACCTACTTTCTGAGAAGTGGTTCACTCATGCCTCTCCTACTCTCTTCAATGCTGGGACCAACCGCCCACAGCTGTCTAGCTGTTTCCTCTTGAGTATGAAAGATGACAGCATTGAAGGAATTTATGATACTCTGAAGCAGTGTGCCTTGATTTCTAAGTCCGCTGGGGGAATTGGTGTTGCTGTGAGTTGTATTCGGGCCACTGGTAGCTACATCGCTGGGACTAATGGCAATTCTAATGGCCTTGTGCCAATGCTGAGAGTATATAACAACACAGCTCGCTATGTGGATCAA
Ensembl | 마우스 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
mouse ... RRM1(20133) , Rrm1(20133)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Jianmei Wu et al.
Journal of chromatography. B, Analytical technologies in the biomedical and life sciences, 1006, 167-178 (2015-11-10)
Simultaneous, quantitative determination of intracellular nucleoside triphosphates and other polar metabolites using liquid chromatography with electrospray ionization tandem mass spectrometry (LC-MS/MS) represents a bioanalytic challenge because of charged, highly hydrophilic analytes presented at a large concentration range in a complex
Rong Yao et al.
PloS one, 10(5), e0125169-e0125169 (2015-05-07)
Pulmonary fibrosis is one of the most common complications of paraquat (PQ) poisoning, which demands for more effective therapies. Accumulating evidence suggests adiponectin (APN) may be a promising therapy against fibrotic diseases. In the current study, we determine whether the
Chou-Kit Chou et al.
International journal of molecular sciences, 16(7), 15104-15117 (2015-07-08)
BubR1 is a critical component of spindle assembly checkpoint, ensuring proper chromatin segregation during mitosis. Recent studies showed that BubR1 was overexpressed in many cancer cells, including oral squamous cell carcinomas (OSCC). However, the effect of BubR1 on metastasis of
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.