콘텐츠로 건너뛰기
Merck
모든 사진(1)

문서

EMU053941

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Itgae

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

CCCTGGACCACTACAAGGAACCCTCTGCCATCTTCCAGCTGCCCTACGAGAAGGACTGCAAGAACAAAGTGTTCTGCATCGCTGAGATCCAGCTGACCACCAACATCTCCCAGCAGGAACTGGTGGTGGGCGTCACAAAGGAGGTGACCATGAACATCAGCCTGACTAACTCTGGAGAGGATTCCTACATGACAAACATGGCTCTCAATTATCCCAGAAACTTACAGTTTAAGAAGATACAAAAGCCAGTATCTCCAGATGTTCAGTGTGATGACCCCAAGCCAGTTGCTTCTGTCCTGGTCATGAACTGCAAGATTGGTCACCCCATACTCAAGAGATCATCTGTGAATGTCTCAGTAACTTGGCAGCTAGAGGAGAGTGTCTTTCCAAATAGGACAGCAGATATCACTGTGACCATCTCCAATTCCAATGAGAAGTCTTTGGCCAGAGAGACACGCAGCCTTCAAT

Ensembl | 마우스 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Jayashree Dolpady et al.
Journal of diabetes research, 2016, 7569431-7569431 (2016-01-19)
The gut microbiota modulates the autoimmune pathogenesis of type 1 diabetes (T1D) via mechanisms that remain largely unknown. The inflammasome components are innate immune sensors that are highly influenced by the gut environment and play pivotal roles in maintaining intestinal
Verena Moosbrugger-Martinz et al.
Journal of cellular and molecular medicine, 20(5), 930-938 (2016-03-05)
Atopic dermatitis (AD) is a widespread inflammatory skin disease with an early onset, characterized by pruritus, eczematous lesions and skin dryness. This chronic relapsing disease is believed to be primarily a result of a defective epidermal barrier function associated with
Duc Dung Le et al.
Respiratory research, 15, 73-73 (2014-07-02)
A neuroimmune crosstalk between dendritic cells (DCs) and airway nerves in the lung has recently been reported. However, the presence of DCs in airway sensory ganglia under normal and allergic conditions has not been explored so far. Therefore, this study

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.