콘텐츠로 건너뛰기
Merck
모든 사진(1)

문서

EMU052501

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Prkaa2

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

100

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

GCTGTGGATCGCCAAATTATGCAGCACCTGAGGTCATCTCAGGAAGGCTGTATGCAGGTCCCGAGGTCGATATCTGGAGCTGTGGTGTCATCCTGTATGCCCTTCTCTGTGGCACCCTCCCTTTCGATGATGAGCACGTGCCTACGCTCTTCAAGAAGATCCGAGGGGGTGTGTTTTACATCCCAGACTATCTCAACCGTTCTGTCGCCACTCTGCTGATGCACATGCTCCAGGTGGACCCCCTGAAGCGAGCGACTATCAAAGACATACGAGAACATGAATGGTTTAAACAGGATTTGCCCAGCTACCTATTTCCTGAAGACCCCTCCTACGATGCGAATGTCATTGTCGATGAGGCTGTGAAGGAAGTCTGTGAGAAATTCGAGTGTACAGAGTCAGAAGTGATGAATAGTCTGTATAGTGGTGACCCTCAAGACCAGCTTGCAGTGGCTTAT

Ensembl | 마우스 수납 번호

ENSMUSG00000028518

NCBI 수납 번호

NM_178143

배송 상태

ambient

저장 온도

−20°C

유전자 정보

mouse ... PRKAA2(108079) , Prkaa2(108079)

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Sreevidya Santha et al.
The Journal of biological chemistry, 290(36), 21865-21875 (2015-07-23)
Prostate cancer (PCa) is one of the most frequently diagnosed cancers in men with limited treatment options for the hormone-resistant forms. Development of novel therapeutic options is critically needed to target advanced forms. Here we demonstrate that combinatorial treatment with
Sravanth K Hindupur et al.
Breast cancer research : BCR, 16(4), 420-420 (2014-08-07)
Matrix detachment triggers anoikis, a form of apoptosis, in most normal epithelial cells, while acquisition of anoikis resistance is a prime requisite for solid tumor growth. Of note, recent studies have revealed that a small population of normal human mammary
Xia Cao et al.
Hypertension research : official journal of the Japanese Society of Hypertension, 37(9), 803-810 (2014-06-27)
The purpose of this study was to determine the effects of resveratrol (RSV) and the molecular mechanisms by which it regulates vascular smooth muscle contraction and blood pressure in mice. In cultured human vascular smooth muscle cells (VSMCs), we found
Chiara Zucal et al.
BMC cancer, 15, 855-855 (2015-11-07)
Nicotinamide phosphoribosyltransferase (NAMPT), the rate-limiting enzyme in NAD(+) biosynthesis from nicotinamide, is one of the major factors regulating cancer cells metabolism and is considered a promising target for treating cancer. The prototypical NAMPT inhibitor FK866 effectively lowers NAD(+) levels in
Teraneh Z Jhaveri et al.
Oncotarget, 6(17), 14754-14765 (2015-07-06)
AMP-activated Protein Kinase (AMPK) activity retards growth of many types of cancers. Investigating effects of AMPK activation on breast cancer cell signaling and survival, we found that breast cancer cell lines with amplification and over-expression of HER2 or EGFR are

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.