콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EMU047431

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Lin28

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

CAGAAGCGAAGATCCAAAGGAGACAGGTGCTACAACTGCGGTGGGCTAGACCATCATGCCAAGGAATGCAAGCTGCCACCCCAGCCCAAGAAGTGCCACTTTTGCCAAAGCATCAACCATATGGTGGCCTCGTGTCCACTGAAGGCCCAGCAGGGCCCCAGTTCTCAGGGAAAGCCTGCCTACTTCCGGGAGGAAGAGGAAGAGATCCACAGCCCTGCCCTGCTCCCAGAAGCCCAGAATTGAGGCCCAGGAGTCAGGGTTATTCTTTGGCTAATGGGGAGTTTAAGGAAAGAGGCATCAATCTGCAGAGTGGAGAAAGTGGGGGTAAGGGTGGGTTGCGTGGGTAGCTTGCACTGCCGTGTCTCAGGCCGGGGTTCCCAGTGTCACCCTGTCTTTCCTTGGAGGGAAGG

Ensembl | 마우스 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

적합한 제품을 찾을 수 없으신가요?  

당사의 제품 선택기 도구.을(를) 시도해 보세요.

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Wensen Ding et al.
International journal of clinical and experimental pathology, 13(5), 1136-1145 (2020-06-09)
As an evolutionarily conserved RNA-binding protein, LIN28 is known to be involved in the regulation of the translation and stability of a large number of mRNAs and the biogenesis of certain miRNAs. Increasing evidence indicates that LIN28 regulates many cellular
Qian Li et al.
Experimental cell research, 388(1), 111718-111718 (2019-12-25)
Successful implantation happens only when the development of a competent blastocyst synchronized with the differentiation of a receptive uterus. The exact mechanism affecting embryo implantation competency is still unclear. Previous data from our laboratory showed that several members of the
Jinzhuo Dou et al.
Molecular oncology, 14(9), 2288-2312 (2020-04-26)
LIN28A is a conserved RNA-binding protein that inhibits the biogenesis of let-7 microRNAs, thus promoting cancer progression. However, mechanisms underlying the activation of the LIN28A-let-7 signaling pathway remain poorly understood. Here, we show that LIN28A is SUMOylated in vivo and in vitro

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.