콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EMU037611

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Twist1

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

ACGAGCTGGACTCCAAGATGGCAAGCTGCAGCTATGTGGCCCACGAGCGGCTCAGCTACGCCTTCTCCGTCTGGAGGATGGAGGGGGCCTGGTCCATGTCCGCGTCCCACTAGCAGCGGAGCTCCCCACCCCCTCTGCAGGCCGGAGACCTAGATGTCATTGTTTCCAGAGAAGGAGAAAATGGACAGTCTAGAGACTCTGGAGCTGGATAACTAAAAATAAATCTATATGACAAAGATTTTCATGGAAATTAGAAGAGCAGAGACCAAATTCACAAGAATCAGGGCGTGGGGCACACTTTTAAAAGAGAAAGCGAGACAGGCCCGTGGACAGAGATTCCCAGAGGGGCAGCAGCAGACCCCCCACACCTCTGCATTCTGATAGAAGTCTGAACACTCGTTTGTGTCCCCCCACCCCACTTTTTGACGAAGAATGTTTTATTTTTATTTTTCATGCATGCATTCTCAAGAGGTCTTGCCAATCAGCCACTGACAGGAA

Ensembl | 마우스 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Shasha Zheng et al.
Journal of immunology (Baltimore, Md. : 1950), 195(1), 217-226 (2015-05-29)
Proper regulation of microbial-induced cytokines is critical to intestinal immune homeostasis. Acute stimulation of nucleotide-binding oligomerization domain 2 (NOD2), the Crohn's disease-associated sensor of bacterial peptidoglycan, induces cytokines. However, chronic NOD2 stimulation in macrophages decreases cytokines upon pattern recognition receptor
Rosemarie Chirco D'Angelo et al.
Molecular cancer research : MCR, 12(9), 1324-1333 (2014-06-05)
Tissue inhibitor of metalloproteinase-1 (TIMP-1) regulates intracellular signaling networks for inhibition of apoptosis. Tetraspanin (CD63), a cell surface binding partner for TIMP-1, was previously shown to regulate integrin-mediated survival pathways in the human breast epithelial cell line MCF10A. In the
Lihua Yang et al.
Scientific reports, 5, 13677-13677 (2015-09-04)
Understanding the molecular mechanism by which epithelial mesenchymal transition (EMT)-mediated cancer metastasis and how microRNA (miRNA) regulates lung cancer progression via Twist1-activated EMT may provide potential therapeutic targets for cancer therapy. Here we found that miR-33a, an intronic miRNA located

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.