설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
ACGAGCTGGACTCCAAGATGGCAAGCTGCAGCTATGTGGCCCACGAGCGGCTCAGCTACGCCTTCTCCGTCTGGAGGATGGAGGGGGCCTGGTCCATGTCCGCGTCCCACTAGCAGCGGAGCTCCCCACCCCCTCTGCAGGCCGGAGACCTAGATGTCATTGTTTCCAGAGAAGGAGAAAATGGACAGTCTAGAGACTCTGGAGCTGGATAACTAAAAATAAATCTATATGACAAAGATTTTCATGGAAATTAGAAGAGCAGAGACCAAATTCACAAGAATCAGGGCGTGGGGCACACTTTTAAAAGAGAAAGCGAGACAGGCCCGTGGACAGAGATTCCCAGAGGGGCAGCAGCAGACCCCCCACACCTCTGCATTCTGATAGAAGTCTGAACACTCGTTTGTGTCCCCCCACCCCACTTTTTGACGAAGAATGTTTTATTTTTATTTTTCATGCATGCATTCTCAAGAGGTCTTGCCAATCAGCCACTGACAGGAA
Ensembl | 마우스 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
mouse ... TWIST1(22160) , Twist1(22160)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Shasha Zheng et al.
Journal of immunology (Baltimore, Md. : 1950), 195(1), 217-226 (2015-05-29)
Proper regulation of microbial-induced cytokines is critical to intestinal immune homeostasis. Acute stimulation of nucleotide-binding oligomerization domain 2 (NOD2), the Crohn's disease-associated sensor of bacterial peptidoglycan, induces cytokines. However, chronic NOD2 stimulation in macrophages decreases cytokines upon pattern recognition receptor
Rosemarie Chirco D'Angelo et al.
Molecular cancer research : MCR, 12(9), 1324-1333 (2014-06-05)
Tissue inhibitor of metalloproteinase-1 (TIMP-1) regulates intracellular signaling networks for inhibition of apoptosis. Tetraspanin (CD63), a cell surface binding partner for TIMP-1, was previously shown to regulate integrin-mediated survival pathways in the human breast epithelial cell line MCF10A. In the
Lihua Yang et al.
Scientific reports, 5, 13677-13677 (2015-09-04)
Understanding the molecular mechanism by which epithelial mesenchymal transition (EMT)-mediated cancer metastasis and how microRNA (miRNA) regulates lung cancer progression via Twist1-activated EMT may provide potential therapeutic targets for cancer therapy. Here we found that miR-33a, an intronic miRNA located
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.