설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
TTTCACAGCCAACGACTCTGGCCATCGCCACTACACCATCGCAGCCCTGCTCAGCCCATACTCCTACAGCACCACGGCTGTCGTCAGCAACCCCCAGAATTGAGAGACTCAGCCCAGGAGGACCAGGATCTTGCCAAAGCAGTAGCATCCCATTTGTACCAAAACAGTGTTCTTGCTCTATAAACCGTGTTAGCAGCTCAGGAAGATGCCGTGAAGCATTCTTATTAAACCACCTGCTATTTCATTCAAACTGTGTTTCTTTTTTATTTCCTCATTTTTCTCCCCTGCTCCTAAAACCCAAAATTTTTTAAAGAATTCTAGAAGGTATGCGATCAAACTTTTTAAAGAAAGAAAATACTTTTTGACTCATGGTTTAAAGGCATCCTTTCCATCTTGGGGAGGTCATGGGTGCTCCTGGCAACTTGCTTGAGGAAGATAGGTCAGAAAGCAGAGTGGACCAACCGTTCAAT
Ensembl | 마우스 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
mouse ... TTR(22139) , Ttr(22139)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
12 - Non Combustible Liquids
WGK
WGK 1
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Nádia P Gonçalves et al.
Acta neuropathologica communications, 2, 177-177 (2014-12-19)
Transthyretin V30M mutation is the most common variant leading to Familial Amyloidotic Polyneuropathy. In this genetic disorder, Transthyretin accumulates preferentially in the extracellular matrix of peripheral and autonomic nervous systems leading to cell death and dysfunction. Thus, knowledge regarding important
Ole B Suhr et al.
Orphanet journal of rare diseases, 10, 109-109 (2015-09-05)
Transthyretin-mediated amyloidosis is an inherited, progressively debilitating disease caused by mutations in the transthyretin gene. This study evaluated the safety, tolerability, pharmacokinetics, and pharmacodynamics of multiple doses of patisiran (ALN-TTR02), a small interfering RNA encapsulated within lipid nanoparticles, in patients
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.