콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EMU024721

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Wnt1

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

100

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

GCGTTCTGCACGAGTGTCTATGAGGTGCCGCGCCTCCGGGAACGGGAACGCTCTCTTCCAGTTCTCAGACACACTCACTGGTCCTGATGTTTGCCCACCCTACCGCGTCCAGCCACAGTCCCAGGGTTCATAGCGATCCATCTCTCCCACCTCCTACCTGGGGACTCCTGAAACCACTTGCCTGAGTCGGCTCGAACCCTTTTGCCATCCTGAGGGCCCTGACCCAGCCTACCTCCCTCCCTCTTTGAGGGAGACTCCTTTTGCACTGCCCCCCAATTTGGCCAGAGGGTGAGAGAAAGATTCTTCTTCTGGGGTGGGGGTGGGGAGGTCAACTCTTGAAGGTGTTGCGGTTCCTGATGTATTTTGCGCTGTGACCTCTTTGGGTATTATCACCTTTCCTTGTCTCTCAGGTCCCTATAGGTCCCTTGAGTTCTCTAACCAGCACCTCTGGG

Ensembl | 마우스 수납 번호

ENSMUSG00000022997

NCBI 수납 번호

NM_021279

배송 상태

ambient

저장 온도

−20°C

유전자 정보

mouse ... WNT1(22408) , Wnt1(22408)

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number
UZU
AOR

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

COA 검색

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Megan M Weivoda et al.
Journal of bone and mineral research : the official journal of the American Society for Bone and Mineral Research, 31(1), 76-85 (2015-06-26)
Osteoblast-mediated bone formation is coupled to osteoclast-mediated bone resorption. These processes become uncoupled with age, leading to increased risk for debilitating fractures. Therefore, understanding how osteoblasts are recruited to sites of resorption is vital to treating age-related bone loss. Osteoclasts
Nithidol Sakunrangsit et al.
Pharmacological research, 150, 104517-104517 (2019-11-07)
Fifty percent of advanced stage ER-positive breast cancer patients develop endocrine resistance. Aberrant activation of Wnt/β-catenin is associated with stem-like phenotypes and epithelial-mesenchymal transition (EMT) process which confers resistance to endocrine therapy. Cancer stem-like cells (CSLCs) can be a vital
Jian Cao et al.
Prostaglandins & other lipid mediators, 116-117, 76-86 (2015-02-14)
Myocardial infarction (MI) is complicated by ventricular fibrosis and associated diastolic and systolic failure. Emerging studies implicate Wnt1 signaling in the formation of new blood vessels. Epoxyeicosatrienoic acids (EETs)-mediated up-regulation of heme oxygenase-1 (HO-1) protects against the detrimental consequences of
Han Yan et al.
Molecular carcinogenesis, 53(12), 960-969 (2013-07-19)
The epithelial-mesenchymal transition (EMT) and acquisition of cancer stem cells (CSCs)-like properties are essential steps in the metastasis and postsurgical recurrence of hepatocellular carcinomas (HCCs). The molecular mechanisms involved, however, remain obscure. As determined by an miRNA microarray analysis, there

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.